/*
**********************************************************************
- * Copyright (C) 2005-2012, International Business Machines
+ * Copyright (C) 2005-2014, International Business Machines
* Corporation and others. All Rights Reserved.
**********************************************************************
*/
-
#include "unicode/utypes.h"
#if !UCONFIG_NO_COLLATION
-#include "unicode/unistr.h"
-#include "unicode/putil.h"
-#include "unicode/usearch.h"
-
#include "cmemory.h"
+#include "cstring.h"
+#include "usrchimp.h"
+
#include "unicode/coll.h"
#include "unicode/tblcoll.h"
-#include "unicode/coleitr.h"
-#include "unicode/ucoleitr.h"
-
-#include "unicode/regex.h" // TODO: make conditional on regexp being built.
-
-#include "unicode/uniset.h"
+#include "unicode/usearch.h"
#include "unicode/uset.h"
#include "unicode/ustring.h"
-#include "hash.h"
-#include "uhash.h"
-#include "ucol_imp.h"
-
-#include "intltest.h"
-#include "ssearch.h"
-#include "unicode/colldata.h"
-#include "unicode/bmsearch.h"
-#include "unicode/bms.h"
+#include "unicode/coleitr.h"
+#include "unicode/regex.h" // TODO: make conditional on regexp being built.
+#include "colldata.h"
+#include "ssearch.h"
#include "xmlparser.h"
-#include "ucbuf.h"
-#include <stdlib.h>
-#include <string.h>
-#include <stdio.h>
+#include <stdio.h> // for sprintf
char testId[100];
errln("Failure in file %s, line %d, test ID = \"%s\"", __FILE__, __LINE__, testId);}}
#define TEST_ASSERT_M(x, m) {if (!(x)) { \
- errln("Failure in file %s, line %d. \"%s\"", __FILE__, __LINE__, m);return;}}
+ dataerrln("Failure in file %s, line %d. \"%s\"", __FILE__, __LINE__, m);return;}}
#define TEST_ASSERT_SUCCESS(errcode) {if (U_FAILURE(errcode)) { \
dataerrln("Failure in file %s, line %d, test ID \"%s\", status = \"%s\"", \
if (exec) monkeyTest(params);
break;
- case 3: name = "bmMonkeyTest";
- if (exec) bmMonkeyTest(params);
+ case 3: name = "sharpSTest";
+ if (exec) sharpSTest();
break;
- case 4: name = "boyerMooreTest";
- if (exec) boyerMooreTest();
- break;
-
- case 5: name = "goodSuffixTest";
+ case 4: name = "goodSuffixTest";
if (exec) goodSuffixTest();
break;
- case 6: name = "searchTime";
+ case 5: name = "searchTime";
if (exec) searchTime();
break;
-
- case 7: name = "bmsTest";
- if (exec) bmsTest();
- break;
-
- case 8: name = "bmSearchTest";
- if (exec) bmSearchTest();
- break;
-
- case 9: name = "udhrTest";
- if (exec) udhrTest();
- break;
- case 10: name = "stringListTest";
- if (exec) stringListTest();
- break;
#endif
default: name = "";
break; //needed to end loop
#endif
}
-struct UdhrTestCase
-{
- const char *locale;
- const char *file;
-};
-
-void SSearchTest::udhrTest()
-{
- UErrorCode status = U_ZERO_ERROR;
- char path[PATH_BUFFER_SIZE];
- const char *udhrPath = getPath(path, "udhr");
-
- if (udhrPath == NULL) {
- // couldn't get path: error message already output...
- return;
- }
-
- UdhrTestCase testCases[] = {
- {"en", "udhr_eng.txt"},
- {"de", "udhr_deu_1996.txt"},
- {"fr", "udhr_fra.txt"},
- {"ru", "udhr_rus.txt"},
- {"th", "udhr_tha.txt"},
- {"ja", "udhr_jpn.txt"},
- {"ko", "udhr_kor.txt"},
- {"zh", "udhr_cmn_hans.txt"},
- {"zh_Hant", "udhr_cmn_hant.txt"}
- };
-
- int32_t testCount = ARRAY_SIZE(testCases);
-
- for (int32_t t = 0; t < testCount; t += 1) {
- int32_t len = 0;
- char *resolvedFileName = NULL;
- const char *encoding = NULL;
- UCHARBUF *ucharBuf = NULL;
-
- ucbuf_resolveFileName(udhrPath, testCases[t].file, NULL, &len, &status);
- resolvedFileName = NEW_ARRAY(char, len);
-
- if(resolvedFileName == NULL){
- continue;
- }
-
- if(status == U_BUFFER_OVERFLOW_ERROR){
- status = U_ZERO_ERROR;
- }
-
- ucbuf_resolveFileName(udhrPath, testCases[t].file, resolvedFileName, &len, &status);
- ucharBuf = ucbuf_open(resolvedFileName, &encoding, TRUE, FALSE, &status);
-
- DELETE_ARRAY(resolvedFileName);
-
- if(U_FAILURE(status)){
- infoln("Could not open the input file %s. Test skipped\n", testCases[t].file);
- continue;
- }
-
- int32_t targetLen = 0;
- const UChar *target = ucbuf_getBuffer(ucharBuf, &targetLen, &status);
-
- /* The first line of the file contains the pattern */
- int32_t start = 0, end = 0, plen = 0;
-
- for(end = start; ; end += 1) {
- UChar ch = target[end];
-
- if (ch == 0x000A || ch == 0x000D || ch == 0x2028) {
- break;
- }
- }
-
- plen = end - start;
-
- UChar *pattern = NEW_ARRAY(UChar, plen);
- for (int32_t i = 0; i < plen; i += 1) {
- pattern[i] = target[start++];
- }
-
- int32_t offset = 0;
- UCollator *coll = ucol_open(testCases[t].locale, &status);
- UCD *ucd = NULL;
- BMS *bms = NULL;
-
- if (U_FAILURE(status)) {
- errln("Could not open collator for %s", testCases[t].locale);
- goto delete_collator;
- }
-
- ucd = ucd_open(coll, &status);
-
- if (U_FAILURE(status)) {
- errln("Could not open CollData object for %s", testCases[t].locale);
- goto delete_ucd;
- }
-
- bms = bms_open(ucd, pattern, plen, target, targetLen, &status);
-
- if (U_FAILURE(status)) {
- errln("Could not open search object for %s", testCases[t].locale);
- goto delete_bms;
- }
-
- start = end = -1;
- while (bms_search(bms, offset, &start, &end)) {
- offset = end;
- }
-
- if (offset == 0) {
- errln("Could not find pattern - locale: %s, file: %s ", testCases[t].locale, testCases[t].file);
- }
-
-delete_bms:
- bms_close(bms);
-
-delete_ucd:
- ucd_close(ucd);
-
-delete_collator:
- ucol_close(coll);
-
- DELETE_ARRAY(pattern);
- ucbuf_close(ucharBuf);
- }
-
- ucd_flushCache();
-}
-
-void SSearchTest::bmSearchTest()
-{
-#if !UCONFIG_NO_REGULAR_EXPRESSIONS
- UErrorCode status = U_ZERO_ERROR;
- char path[PATH_BUFFER_SIZE];
- const char *testFilePath = getPath(path, "ssearch.xml");
-
- if (testFilePath == NULL) {
- return; /* Couldn't get path: error message already output. */
- }
-
- UXMLParser *parser = UXMLParser::createParser(status);
- TEST_ASSERT_SUCCESS(status);
- UXMLElement *root = parser->parseFile(testFilePath, status);
- TEST_ASSERT_SUCCESS(status);
- if (U_FAILURE(status)) {
- return;
- }
-
- const UnicodeString *debugTestCase = root->getAttribute("debug");
- if (debugTestCase != NULL) {
-// setenv("USEARCH_DEBUG", "1", 1);
- }
-
-
- const UXMLElement *testCase;
- int32_t tc = 0;
-
- while((testCase = root->nextChildElement(tc)) != NULL) {
-
- if (testCase->getTagName().compare("test-case") != 0) {
- errln("ssearch, unrecognized XML Element in test file");
- continue;
- }
- const UnicodeString *id = testCase->getAttribute("id");
- *testId = 0;
- if (id != NULL) {
- id->extract(0, id->length(), testId, sizeof(testId), US_INV);
- }
-
- // If debugging test case has been specified and this is not it, skip to next.
- if (id!=NULL && debugTestCase!=NULL && *id != *debugTestCase) {
- continue;
- }
- //
- // Get the requested collation strength.
- // Default is tertiary if the XML attribute is missing from the test case.
- //
- const UnicodeString *strength = testCase->getAttribute("strength");
- UColAttributeValue collatorStrength = UCOL_PRIMARY;
- if (strength==NULL) { collatorStrength = UCOL_TERTIARY;}
- else if (*strength=="PRIMARY") { collatorStrength = UCOL_PRIMARY;}
- else if (*strength=="SECONDARY") { collatorStrength = UCOL_SECONDARY;}
- else if (*strength=="TERTIARY") { collatorStrength = UCOL_TERTIARY;}
- else if (*strength=="QUATERNARY") { collatorStrength = UCOL_QUATERNARY;}
- else if (*strength=="IDENTICAL") { collatorStrength = UCOL_IDENTICAL;}
- else {
- // Bogus value supplied for strength. Shouldn't happen, even from
- // typos, if the XML source has been validated.
- // This assert is a little deceiving in that strength can be
- // any of the allowed values, not just TERTIARY, but it will
- // do the job of getting the error output.
- TEST_ASSERT(*strength=="TERTIARY")
- }
-
- //
- // Get the collator normalization flag. Default is UCOL_OFF.
- //
- UColAttributeValue normalize = UCOL_OFF;
- const UnicodeString *norm = testCase->getAttribute("norm");
- TEST_ASSERT (norm==NULL || *norm=="ON" || *norm=="OFF");
- if (norm!=NULL && *norm=="ON") {
- normalize = UCOL_ON;
- }
-
- //
- // Get the alternate_handling flag. Default is UCOL_NON_IGNORABLE.
- //
- UColAttributeValue alternateHandling = UCOL_NON_IGNORABLE;
- const UnicodeString *alt = testCase->getAttribute("alternate_handling");
- TEST_ASSERT (alt == NULL || *alt == "SHIFTED" || *alt == "NON_IGNORABLE");
- if (alt != NULL && *alt == "SHIFTED") {
- alternateHandling = UCOL_SHIFTED;
- }
-
- const UnicodeString defLocale("en");
- char clocale[100];
- const UnicodeString *locale = testCase->getAttribute("locale");
- if (locale == NULL || locale->length()==0) {
- locale = &defLocale;
- };
- locale->extract(0, locale->length(), clocale, sizeof(clocale), NULL);
-
-
- UnicodeString text;
- UnicodeString target;
- UnicodeString pattern;
- int32_t expectedMatchStart = -1;
- int32_t expectedMatchLimit = -1;
- const UXMLElement *n;
- int32_t nodeCount = 0;
-
- n = testCase->getChildElement("pattern");
- TEST_ASSERT(n != NULL);
- if (n==NULL) {
- continue;
- }
- text = n->getText(FALSE);
- text = text.unescape();
- pattern.append(text);
- nodeCount++;
-
- n = testCase->getChildElement("pre");
- if (n!=NULL) {
- text = n->getText(FALSE);
- text = text.unescape();
- target.append(text);
- nodeCount++;
- }
-
- n = testCase->getChildElement("m");
- if (n!=NULL) {
- expectedMatchStart = target.length();
- text = n->getText(FALSE);
- text = text.unescape();
- target.append(text);
- expectedMatchLimit = target.length();
- nodeCount++;
- }
-
- n = testCase->getChildElement("post");
- if (n!=NULL) {
- text = n->getText(FALSE);
- text = text.unescape();
- target.append(text);
- nodeCount++;
- }
-
- // Check that there weren't extra things in the XML
- TEST_ASSERT(nodeCount == testCase->countChildren());
-
- // Open a collator and StringSearch based on the parameters
- // obtained from the XML.
- //
- status = U_ZERO_ERROR;
- UCollator *collator = ucol_open(clocale, &status);
- ucol_setStrength(collator, collatorStrength);
- ucol_setAttribute(collator, UCOL_NORMALIZATION_MODE, normalize, &status);
- ucol_setAttribute(collator, UCOL_ALTERNATE_HANDLING, alternateHandling, &status);
- UCD *ucd = ucd_open(collator, &status);
- BMS *bms = bms_open(ucd, pattern.getBuffer(), pattern.length(), target.getBuffer(), target.length(), &status);
-
- TEST_ASSERT_SUCCESS(status);
- if (U_FAILURE(status)) {
- bms_close(bms);
- ucd_close(ucd);
- ucol_close(collator);
- continue;
- }
-
- int32_t foundStart = 0;
- int32_t foundLimit = 0;
- UBool foundMatch;
-
- //
- // Do the search, check the match result against the expected results.
- //
- foundMatch = bms_search(bms, 0, &foundStart, &foundLimit);
- //TEST_ASSERT_SUCCESS(status);
- if ((foundMatch && expectedMatchStart < 0) ||
- (foundStart != expectedMatchStart) ||
- (foundLimit != expectedMatchLimit)) {
- TEST_ASSERT(FALSE); // ouput generic error position
- infoln("Found, expected match start = %d, %d \n"
- "Found, expected match limit = %d, %d",
- foundStart, expectedMatchStart, foundLimit, expectedMatchLimit);
- }
-
- bms_close(bms);
- ucd_close(ucd);
- ucol_close(collator);
- }
-
- ucd_flushCache();
- delete root;
- delete parser;
-#endif
-}
-
struct Order
{
int32_t order;
col->setAttribute(UCOL_NORMALIZATION_MODE, UCOL_ON, status);
for(int32_t i = 0; i < testCount; i += 1) {
- if (!isICUVersionAtLeast(50, 0) && i>=4 && i<=6) {
- continue; // timebomb until ticket #8080 is resolved
- }
UnicodeString ts = CharsToUnicodeString(test[i]);
CollationElementIterator *iter = col->createCollationElementIterator(ts);
OrderList forwardList;
}
#endif
-#if 1
-
-struct PCE
-{
- uint64_t ce;
- int32_t lowOffset;
- int32_t highOffset;
-};
-
-class PCEList
-{
-public:
- PCEList(UCollator *coll, const UnicodeString &string);
- ~PCEList();
-
- int32_t size() const;
-
- const PCE *get(int32_t index) const;
-
- int32_t getLowOffset(int32_t index) const;
- int32_t getHighOffset(int32_t index) const;
- uint64_t getOrder(int32_t index) const;
-
- UBool matchesAt(int32_t offset, const PCEList &other) const;
-
- uint64_t operator[](int32_t index) const;
-
-private:
- void add(uint64_t ce, int32_t low, int32_t high);
-
- PCE *list;
- int32_t listMax;
- int32_t listSize;
-};
-
-PCEList::PCEList(UCollator *coll, const UnicodeString &string)
-{
- UErrorCode status = U_ZERO_ERROR;
- UCollationElements *elems = ucol_openElements(coll, string.getBuffer(), string.length(), &status);
- uint64_t order;
- int32_t low, high;
-
- list = new PCE[listMax];
-
- ucol_setOffset(elems, 0, &status);
-
- do {
- order = ucol_nextProcessed(elems, &low, &high, &status);
- add(order, low, high);
- } while (order != UCOL_PROCESSED_NULLORDER);
-
- ucol_closeElements(elems);
-}
-
-PCEList::~PCEList()
-{
- delete[] list;
-}
-
-void PCEList::add(uint64_t order, int32_t low, int32_t high)
-{
- if (listSize >= listMax) {
- listMax *= 2;
-
- PCE *newList = new PCE[listMax];
-
- uprv_memcpy(newList, list, listSize * sizeof(Order));
- delete[] list;
- list = newList;
- }
-
- list[listSize].ce = order;
- list[listSize].lowOffset = low;
- list[listSize].highOffset = high;
-
- listSize += 1;
-}
-
-const PCE *PCEList::get(int32_t index) const
-{
- if (index >= listSize) {
- return NULL;
- }
-
- return &list[index];
-}
-
-int32_t PCEList::getLowOffset(int32_t index) const
-{
- const PCE *pce = get(index);
-
- if (pce != NULL) {
- return pce->lowOffset;
- }
-
- return -1;
-}
-
-int32_t PCEList::getHighOffset(int32_t index) const
-{
- const PCE *pce = get(index);
-
- if (pce != NULL) {
- return pce->highOffset;
- }
-
- return -1;
-}
-
-uint64_t PCEList::getOrder(int32_t index) const
-{
- const PCE *pce = get(index);
-
- if (pce != NULL) {
- return pce->ce;
- }
-
- return UCOL_PROCESSED_NULLORDER;
-}
-
-int32_t PCEList::size() const
-{
- return listSize;
-}
-
-UBool PCEList::matchesAt(int32_t offset, const PCEList &other) const
-{
- // NOTE: sizes include the NULLORDER, which we don't want to compare.
- int32_t otherSize = other.size() - 1;
-
- if (listSize - 1 - offset < otherSize) {
- return FALSE;
- }
-
- for (int32_t i = offset, j = 0; j < otherSize; i += 1, j += 1) {
- if (getOrder(i) != other.getOrder(j)) {
- return FALSE;
- }
- }
-
- return TRUE;
-}
-
-uint64_t PCEList::operator[](int32_t index) const
-{
- return getOrder(index);
-}
-
-void SSearchTest::boyerMooreTest()
+void SSearchTest::sharpSTest()
{
UErrorCode status = U_ZERO_ERROR;
UCollator *coll = NULL;
- CollData *data = NULL;
- const CEList* ce = NULL;
- const CEList* ce1 = NULL;
UnicodeString lp = "fuss";
UnicodeString sp = "fu\\u00DF";
- BoyerMooreSearch *longPattern = NULL;
- BoyerMooreSearch *shortPattern = NULL;
UnicodeString targets[] = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball",
"ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF",
"fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"};
int32_t start = -1, end = -1;
coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status);
- if (U_FAILURE(status)) {
- errcheckln(status, "Could not open collator. - %s", u_errorName(status));
- return;
- }
-
- data = CollData::open(coll, status);
- if (U_FAILURE(status)) {
- errln("Could not open CollData object.");
- goto close_data;
- }
-
- data->getDynamicClassID();
- if (U_FAILURE(status)) {
- errln("Could not get dynamic class ID of CollData.");
- goto close_patterns;
- }
-
- data->getStaticClassID();
- if (U_FAILURE(status)) {
- errln("Could not get static class ID of CollData.");
- goto close_patterns;
- }
-
- longPattern = new BoyerMooreSearch(data, lp.unescape(), NULL, status);
- shortPattern = new BoyerMooreSearch(data, sp.unescape(), NULL, status);
- if (U_FAILURE(status)) {
- errln("Could not create pattern objects.");
- goto close_patterns;
- }
-
- longPattern->getBadCharacterTable();
- shortPattern->getBadCharacterTable();
- if (U_FAILURE(status)) {
- errln("Could not get bad character table.");
- goto close_patterns;
- }
-
- longPattern->getGoodSuffixTable();
- shortPattern->getGoodSuffixTable();
- if (U_FAILURE(status)) {
- errln("Could not get good suffix table.");
- goto close_patterns;
- }
-
- longPattern->getDynamicClassID();
- shortPattern->getDynamicClassID();
- if (U_FAILURE(status)) {
- errln("Could not get dynamic class ID of BoyerMooreSearch.");
- goto close_patterns;
- }
-
- longPattern->getStaticClassID();
- shortPattern->getStaticClassID();
- if (U_FAILURE(status)) {
- errln("Could not get static class ID of BoyerMooreSearch.");
- goto close_patterns;
- }
-
- longPattern->getData();
- shortPattern->getData();
- if (U_FAILURE(status)) {
- errln("Could not get collate data.");
- goto close_patterns;
- }
-
- ce = longPattern->getPatternCEs();
- ce1 = shortPattern->getPatternCEs();
- if (U_FAILURE(status)) {
- errln("Could not get pattern CEs.");
- goto close_patterns;
- }
-
- ce->getDynamicClassID();
- ce1->getDynamicClassID();
- if (U_FAILURE(status)) {
- errln("Could not get dynamic class ID of CEList.");
- goto close_patterns;
- }
-
- ce->getStaticClassID();
- ce1->getStaticClassID();
- if (U_FAILURE(status)) {
- errln("Could not get static class ID of CEList.");
- goto close_patterns;
- }
-
- if(data->minLengthInChars(ce,0) != 3){
- errln("Minimal Length in Characters for 'data' with 'ce' was suppose to give 3.");
- goto close_patterns;
- }
-
- if(data->minLengthInChars(ce1,0) != 3){
- errln("Minimal Length in Characters for 'data' with 'ce1' was suppose to give 3.");
- goto close_patterns;
- }
-
- for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) {
- UnicodeString target = targets[t].unescape();
-
- longPattern->setTargetString(&target, status);
- if (longPattern->search(0, start, end)) {
- logln("Test %d: found long pattern at [%d, %d].", t, start, end);
- } else {
- errln("Test %d: did not find long pattern.", t);
- }
-
- shortPattern->setTargetString(&target, status);
- if (shortPattern->search(0, start, end)) {
- logln("Test %d: found short pattern at [%d, %d].", t, start, end);
- } else {
- errln("Test %d: did not find short pattern.", t);
- }
-
- if(longPattern->empty()){
- errln("Test %d: Long pattern should not have been empty.");
- }
-
- if(shortPattern->empty()){
- errln("Test %d: Short pattern should not have been empty.");
- }
- }
-
-close_patterns:
- delete shortPattern;
- delete longPattern;
-
-close_data:
- CollData::close(data);
- ucol_close(coll);
-}
+ TEST_ASSERT_SUCCESS(status);
-void SSearchTest::bmsTest()
-{
- UErrorCode status = U_ZERO_ERROR;
- UCollator *coll = NULL;
- UCD *data = NULL;
- UnicodeString lp = "fuss";
- UnicodeString lpu = lp.unescape();
- UnicodeString sp = "fu\\u00DF";
- UnicodeString spu = sp.unescape();
- BMS *longPattern = NULL;
- BMS *shortPattern = NULL;
- UnicodeString targets[] = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball",
- "ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF",
- "fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"};
- int32_t start = -1, end = -1;
+ UnicodeString lpUnescaped = lp.unescape();
+ UnicodeString spUnescaped = sp.unescape();
- coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status);
- if (U_FAILURE(status)) {
- errcheckln(status, "Could not open collator. - %s", u_errorName(status));
- return;
- }
-
- data = ucd_open(coll, &status);
- if (U_FAILURE(status)) {
- errln("Could not open CollData object.");
- goto close_data;
- }
+ LocalUStringSearchPointer ussLong(usearch_openFromCollator(lpUnescaped.getBuffer(), lpUnescaped.length(),
+ lpUnescaped.getBuffer(), lpUnescaped.length(), // actual test data will be set later
+ coll,
+ NULL, // the break iterator
+ &status));
- longPattern = bms_open(data, lpu.getBuffer(), lpu.length(), NULL, 0, &status);
- shortPattern = bms_open(data, spu.getBuffer(), spu.length(), NULL, 0, &status);
- if (U_FAILURE(status)) {
- errln("Couldn't open pattern objects.");
- goto close_patterns;
- }
+ LocalUStringSearchPointer ussShort(usearch_openFromCollator(spUnescaped.getBuffer(), spUnescaped.length(),
+ spUnescaped.getBuffer(), spUnescaped.length(), // actual test data will be set later
+ coll,
+ NULL, // the break iterator
+ &status));
+ TEST_ASSERT_SUCCESS(status);
for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) {
+ UBool bFound;
UnicodeString target = targets[t].unescape();
- bms_setTargetString(longPattern, target.getBuffer(), target.length(), &status);
- if (bms_search(longPattern, 0, &start, &end)) {
+ start = end = -1;
+ usearch_setText(ussLong.getAlias(), target.getBuffer(), target.length(), &status);
+ bFound = usearch_search(ussLong.getAlias(), 0, &start, &end, &status);
+ TEST_ASSERT_SUCCESS(status);
+ if (bFound) {
logln("Test %d: found long pattern at [%d, %d].", t, start, end);
} else {
- errln("Test %d: did not find long pattern.", t);
+ dataerrln("Test %d: did not find long pattern.", t);
}
- bms_setTargetString(shortPattern, target.getBuffer(), target.length(), &status);
- if (bms_search(shortPattern, 0, &start, &end)) {
- logln("Test %d: found short pattern at [%d, %d].", t, start, end);
+ usearch_setText(ussShort.getAlias(), target.getBuffer(), target.length(), &status);
+ bFound = usearch_search(ussShort.getAlias(), 0, &start, &end, &status);
+ TEST_ASSERT_SUCCESS(status);
+ if (bFound) {
+ logln("Test %d: found long pattern at [%d, %d].", t, start, end);
} else {
- errln("Test %d: did not find short pattern.", t);
+ dataerrln("Test %d: did not find long pattern.", t);
}
}
- /* Add better coverage for bms code. */
- if(bms_empty(longPattern)) {
- errln("FAIL: longgPattern is empty.");
- }
-
- if (!bms_getData(longPattern)) {
- errln("FAIL: bms_getData returned NULL.");
- }
-
- if (!ucd_getCollator(data)) {
- errln("FAIL: ucd_getCollator returned NULL.");
- }
-
-close_patterns:
- bms_close(shortPattern);
- bms_close(longPattern);
-
-close_data:
- ucd_close(data);
- ucd_freeCache();
ucol_close(coll);
}
{
UErrorCode status = U_ZERO_ERROR;
UCollator *coll = NULL;
- CollData *data = NULL;
UnicodeString pat = /*"gcagagag"*/ "fxeld";
UnicodeString target = /*"gcatcgcagagagtatacagtacg"*/ "cloveldfxeld";
- BoyerMooreSearch *pattern = NULL;
int32_t start = -1, end = -1;
+ UBool bFound;
coll = ucol_open(NULL, &status);
- if (U_FAILURE(status)) {
- errcheckln(status, "Couldn't open collator. - %s", u_errorName(status));
- return;
- }
-
- data = CollData::open(coll, status);
- if (U_FAILURE(status)) {
- errln("Couldn't open CollData object.");
- goto close_data;
- }
+ TEST_ASSERT_SUCCESS(status);
- pattern = new BoyerMooreSearch(data, pat, &target, status);
- if (U_FAILURE(status)) {
- errln("Couldn't open pattern object.");
- goto close_pattern;
- }
+ LocalUStringSearchPointer ss(usearch_openFromCollator(pat.getBuffer(), pat.length(),
+ target.getBuffer(), target.length(),
+ coll,
+ NULL, // the break iterator
+ &status));
+ TEST_ASSERT_SUCCESS(status);
- if (pattern->search(0, start, end)) {
+ bFound = usearch_search(ss.getAlias(), 0, &start, &end, &status);
+ TEST_ASSERT_SUCCESS(status);
+ if (bFound) {
logln("Found pattern at [%d, %d].", start, end);
} else {
- errln("Did not find pattern.");
+ dataerrln("Did not find pattern.");
}
-close_pattern:
- delete pattern;
-
-close_data:
- CollData::close(data);
ucol_close(coll);
}
"Neither to been y-buried nor y-brent,\n"
"But maketh houndes ete hem in despyt. zet'\n";
-#define TEST_BOYER_MOORE 1
const char *cPattern = "maketh houndes ete hem";
//const char *cPattern = "Whylom";
//const char *cPattern = "zet";
LocalUCollatorPointer collator(ucol_open("en", &status));
- CollData *data = CollData::open(collator.getAlias(), status);
- if (U_FAILURE(status) || collator.isNull() || data == NULL) {
- errcheckln(status, "Unable to open UCollator or CollData. - %s", u_errorName(status));
- return;
- }
//ucol_setStrength(collator.getAlias(), collatorStrength);
//ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status);
UnicodeString uPattern = cPattern;
-#ifndef TEST_BOYER_MOORE
LocalUStringSearchPointer uss(usearch_openFromCollator(uPattern.getBuffer(), uPattern.length(),
target.getBuffer(), target.length(),
collator.getAlias(),
NULL, // the break iterator
&status));
TEST_ASSERT_SUCCESS(status);
-#else
- BoyerMooreSearch bms(data, uPattern, &target, status);
- TEST_ASSERT_SUCCESS(status);
-#endif
// int32_t foundStart;
// int32_t foundEnd;
int32_t refMatchPos = (int32_t)(pm - longishText);
int32_t icuMatchPos;
int32_t icuMatchEnd;
-#ifndef TEST_BOYER_MOORE
usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status);
TEST_ASSERT_SUCCESS(status);
-#else
- found = bms.search(0, icuMatchPos, icuMatchEnd);
-#endif
TEST_ASSERT_M(refMatchPos == icuMatchPos, "strstr and icu give different match positions.");
int32_t i;
// Try loopcounts around 100000 to some millions, depending on the operation,
// to get runtimes of at least several seconds.
for (i=0; i<10000; i++) {
-#ifndef TEST_BOYER_MOORE
found = usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status);
-#else
- found = bms.search(0, icuMatchPos, icuMatchEnd);
-#endif
+ (void)found; // Suppress set but not used warning.
//TEST_ASSERT_SUCCESS(status);
//TEST_ASSERT(found);
}
//printf("%ld, %d\n", pm-longishText, j);
-#ifdef TEST_BOYER_MOORE
- CollData::close(data);
-#endif
}
-#endif
//----------------------------------------------------------------------------------------
//
} while (! matches);
}
-//
-// Find the next acceptable boundary following the specified starting index
-// in the target text being searched.
-// TODO: refine what is an acceptable boundary. For the moment,
-// choose the next position not within a combining sequence.
-//
-#if 0
-static int32_t nextBoundaryAfter(const UnicodeString &string, int32_t startIndex) {
- const UChar *text = string.getBuffer();
- int32_t textLen = string.length();
-
- if (startIndex >= textLen) {
- return startIndex;
- }
-
- UChar32 c;
- int32_t i = startIndex;
-
- U16_NEXT(text, i, textLen, c);
-
- // If we are on a control character, stop without looking for combining marks.
- // Control characters do not combine.
- int32_t gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
- if (gcProperty==U_GCB_CONTROL || gcProperty==U_GCB_LF || gcProperty==U_GCB_CR) {
- return i;
- }
-
- // The initial character was not a control, and can thus accept trailing
- // combining characters. Advance over however many of them there are.
- int32_t indexOfLastCharChecked;
-
- for (;;) {
- indexOfLastCharChecked = i;
-
- if (i>=textLen) {
- break;
- }
-
- U16_NEXT(text, i, textLen, c);
- gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
-
- if (gcProperty != U_GCB_EXTEND && gcProperty != U_GCB_SPACING_MARK) {
- break;
- }
- }
-
- return indexOfLastCharChecked;
-}
-#endif
-
-#if 0
-static UBool isInCombiningSequence(const UnicodeString &string, int32_t index) {
- const UChar *text = string.getBuffer();
- int32_t textLen = string.length();
-
- if (index>=textLen || index<=0) {
- return FALSE;
- }
-
- // If the character at the current index is not a GRAPHEME_EXTEND
- // then we can not be within a combining sequence.
- UChar32 c;
- U16_GET(text, 0, index, textLen, c);
- int32_t gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
- if (gcProperty != U_GCB_EXTEND && gcProperty != U_GCB_SPACING_MARK) {
- return FALSE;
- }
-
- // We are at a combining mark. If the preceding character is anything
- // except a CONTROL, CR or LF, we are in a combining sequence.
- U16_PREV(text, 0, index, c);
- gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
-
- return !(gcProperty==U_GCB_CONTROL || gcProperty==U_GCB_LF || gcProperty==U_GCB_CR);
-}
-#endif
-
static UBool simpleSearch(UCollator *coll, const UnicodeString &target, int32_t offset, const UnicodeString &pattern, int32_t &matchStart, int32_t &matchEnd)
{
UErrorCode status = U_ZERO_ERROR;
}
params.extract(m.start(1, status), paramLength, valString, sizeof(valString));
- val = strtol(valString, NULL, 10);
+ val = uprv_strtol(valString, NULL, 10);
// Delete this parameter from the params string.
m.reset();
notFoundCount += 1;
}
- return notFoundCount;
-}
-
-static void hexForUnicodeString(const UnicodeString &ustr, char * cbuf, int32_t cbuflen)
-{
- int32_t ustri, ustrlen = ustr.length();
-
- for (ustri = 0; ustri < ustrlen; ++ustri) {
- if (cbuflen >= 9 /* format width for single code unit(5) + terminating ellipsis(3) + null(1) */) {
- int len = sprintf(cbuf, " %04X", ustr.charAt(ustri));
- cbuflen -= len;
- cbuf += len;
- } else {
- if (cbuflen >= 4 /* terminating ellipsis(3) + null(1) */) {
- sprintf(cbuf, "...");
- } else if (cbuflen >= 1) {
- cbuf = 0;
- }
- break;
- }
- }
-}
-
-int32_t SSearchTest::bmMonkeyTestCase(UCollator *coll, const UnicodeString &testCase, const UnicodeString &pattern, const UnicodeString &altPattern,
- BoyerMooreSearch *bms, BoyerMooreSearch *abms,
- const char *name, const char *strength, uint32_t seed)
-{
- UErrorCode status = U_ZERO_ERROR;
- int32_t actualStart = -1, actualEnd = -1;
- //int32_t expectedStart = prefix.length(), expectedEnd = prefix.length() + altPattern.length();
- int32_t expectedStart = -1, expectedEnd = -1;
- int32_t notFoundCount = 0;
- char hexbuf[128];
-
- // **** TODO: find *all* matches, not just first one ****
- simpleSearch(coll, testCase, 0, pattern, expectedStart, expectedEnd);
-
- bms->setTargetString(&testCase, status);
- bms->search(0, actualStart, actualEnd);
-
- if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {
- hexForUnicodeString(pattern, hexbuf, sizeof(hexbuf));
- errln("Boyer-Moore Search for <pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"
- " strength=%s seed=%d <pattern>: %s",
- name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed, hexbuf);
- }
-
- if (expectedStart == -1 && actualStart == -1) {
- notFoundCount += 1;
- }
-
- // **** TODO: find *all* matches, not just first one ****
- simpleSearch(coll, testCase, 0, altPattern, expectedStart, expectedEnd);
-
- abms->setTargetString(&testCase, status);
- abms->search(0, actualStart, actualEnd);
-
- if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {
- hexForUnicodeString(altPattern, hexbuf, sizeof(hexbuf));
- errln("Boyer-Moore Search for <alt_pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"
- " strength=%s seed=%d <pattern>: %s",
- name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed, hexbuf);
- }
-
- if (expectedStart == -1 && actualStart == -1) {
- notFoundCount += 1;
- }
-
-
return notFoundCount;
}
#endif
return;
}
- CollData *monkeyData = CollData::open(coll, status);
+ CollData *monkeyData = new CollData(coll, status);
USet *expansions = uset_openEmpty();
USet *contractions = uset_openEmpty();
ucol_setStrength(coll, strengths[s]);
// TODO: try alternate prefix and suffix too?
- // TODO: alterntaes are only equal at primary strength. Is this OK?
+ // TODO: alternates are only equal at primary strength. Is this OK?
for(int32_t t = 0; t < loopCount; t += 1) {
uint32_t seed = m_seed;
// int32_t nmc = 0;
uset_close(contractions);
uset_close(expansions);
uset_close(letters);
-
- CollData::close(monkeyData);
-
- ucol_close(coll);
-}
-
-void SSearchTest::bmMonkeyTest(char *params)
-{
- static const UChar skipChars[] = { 0x0E40, 0x0E41, 0x0E42, 0x0E43, 0x0E44, 0xAAB5, 0xAAB6, 0xAAB9, 0xAABB, 0xAABC, 0 }; // for timebomb
- // ook!
- UErrorCode status = U_ZERO_ERROR;
- UCollator *coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status);
-
- if (U_FAILURE(status)) {
- errcheckln(status, "Failed to create collator in MonkeyTest! - %s", u_errorName(status));
- return;
- }
-
- CollData *monkeyData = CollData::open(coll, status);
-
- USet *expansions = uset_openEmpty();
- USet *contractions = uset_openEmpty();
-
- ucol_getContractionsAndExpansions(coll, contractions, expansions, FALSE, &status);
-
- U_STRING_DECL(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);
- U_STRING_INIT(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);
- USet *letters = uset_openPattern(letter_pattern, 39, &status);
- SetMonkey letterMonkey(letters);
- StringSetMonkey contractionMonkey(contractions, coll, monkeyData);
- StringSetMonkey expansionMonkey(expansions, coll, monkeyData);
- UnicodeString testCase;
- UnicodeString alternate;
- UnicodeString pattern, altPattern;
- UnicodeString prefix, altPrefix;
- UnicodeString suffix, altSuffix;
-
- Monkey *monkeys[] = {
- &letterMonkey,
- &contractionMonkey,
- &expansionMonkey,
- &contractionMonkey,
- &expansionMonkey,
- &contractionMonkey,
- &expansionMonkey,
- &contractionMonkey,
- &expansionMonkey};
- int32_t monkeyCount = sizeof(monkeys) / sizeof(monkeys[0]);
- // int32_t nonMatchCount = 0;
-
- UCollationStrength strengths[] = {UCOL_PRIMARY, UCOL_SECONDARY, UCOL_TERTIARY};
- const char *strengthNames[] = {"primary", "secondary", "tertiary"};
- int32_t strengthCount = sizeof(strengths) / sizeof(strengths[0]);
- int32_t loopCount = quick? 1000 : 10000;
- int32_t firstStrength = 0;
- int32_t lastStrength = strengthCount - 1; //*/ 0;
-
- if (params != NULL) {
-#if !UCONFIG_NO_REGULAR_EXPRESSIONS
- UnicodeString p(params);
-
- loopCount = getIntParam("loop", p, loopCount);
- m_seed = getIntParam("seed", p, m_seed);
-
- RegexMatcher m(" *strength *= *(primary|secondary|tertiary) *", p, 0, status);
- if (m.find()) {
- UnicodeString breakType = m.group(1, status);
-
- for (int32_t s = 0; s < strengthCount; s += 1) {
- if (breakType == strengthNames[s]) {
- firstStrength = lastStrength = s;
- break;
- }
- }
-
- m.reset();
- p = m.replaceFirst("", status);
- }
-
- if (RegexMatcher("\\S", p, 0, status).find()) {
- // Each option is stripped out of the option string as it is processed.
- // All options have been checked. The option string should have been completely emptied..
- char buf[100];
- p.extract(buf, sizeof(buf), NULL, status);
- buf[sizeof(buf)-1] = 0;
- errln("Unrecognized or extra parameter: %s\n", buf);
- return;
- }
-#else
- infoln("SSearchTest built with UCONFIG_NO_REGULAR_EXPRESSIONS: ignoring parameters.");
-#endif
- }
-
- for(int32_t s = firstStrength; s <= lastStrength; s += 1) {
- int32_t notFoundCount = 0;
-
- logln("Setting strength to %s.", strengthNames[s]);
- ucol_setStrength(coll, strengths[s]);
-
- CollData *data = CollData::open(coll, status);
-
- UnicodeString skipString(skipChars); // for timebomb
- UnicodeSet* skipSet = UnicodeSet::createFromAll(skipString); // for timebomb
- // TODO: try alternate prefix and suffix too?
- // TODO: alterntaes are only equal at primary strength. Is this OK?
- for(int32_t t = 0; t < loopCount; t += 1) {
- uint32_t seed = m_seed;
- // int32_t nmc = 0;
-
- generateTestCase(coll, monkeys, monkeyCount, pattern, altPattern);
- generateTestCase(coll, monkeys, monkeyCount, prefix, altPrefix);
- generateTestCase(coll, monkeys, monkeyCount, suffix, altSuffix);
-
- if (!isICUVersionAtLeast(50, 0) && skipSet->containsSome(pattern)) {
- continue; // timebomb until ticket #8080 is resolved
- }
-
- BoyerMooreSearch pat(data, pattern, NULL, status);
- BoyerMooreSearch alt(data, altPattern, NULL, status);
-
- // **** need a better way to deal with this ****
-#if 0
- if (pat.empty() ||
- alt.empty()) {
- continue;
- }
-#endif
-
- // pattern
- notFoundCount += bmMonkeyTestCase(coll, pattern, pattern, altPattern, &pat, &alt, "pattern", strengthNames[s], seed);
-
- testCase.remove();
- testCase.append(prefix);
- testCase.append(/*alt*/pattern);
-
- // prefix + pattern
- notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "prefix + pattern", strengthNames[s], seed);
-
- testCase.append(suffix);
-
- // prefix + pattern + suffix
- notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "prefix + pattern + suffix", strengthNames[s], seed);
-
- testCase.remove();
- testCase.append(pattern);
- testCase.append(suffix);
-
- // pattern + suffix
- notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "pattern + suffix", strengthNames[s], seed);
- }
- delete skipSet; // for timebomb
-
- CollData::close(data);
-
- logln("For strength %s the not found count is %d.", strengthNames[s], notFoundCount);
- }
-
- uset_close(contractions);
- uset_close(expansions);
- uset_close(letters);
-
- CollData::close(monkeyData);
+ delete monkeyData;
ucol_close(coll);
}
-void SSearchTest::stringListTest(){
- UErrorCode status = U_ZERO_ERROR;
- StringList *sl = new StringList(status);
- if(U_FAILURE(status)){
- errln("ERROR: stringListTest: Could not start StringList");
- }
-
- const UChar chars[] = {
- 0x0000
- };
- sl->add(chars, (int32_t) 0, status);
- if(U_FAILURE(status)){
- errln("ERROR: stringListTest: StringList::add");
- }
-
- if(sl->getDynamicClassID() != StringList::getStaticClassID()){
- errln("ERROR: stringListTest: getDynamicClassID and getStaticClassID does not match");
- }
- delete sl;
-}
-
#endif
#endif
projects / apple / icu.git / blobdiff