]>
Commit | Line | Data |
---|---|---|
1 | /* | |
2 | ********************************************************************** | |
3 | * Copyright (C) 2005-2010, International Business Machines | |
4 | * Corporation and others. All Rights Reserved. | |
5 | ********************************************************************** | |
6 | */ | |
7 | ||
8 | ||
9 | #include "unicode/utypes.h" | |
10 | ||
11 | #if !UCONFIG_NO_COLLATION | |
12 | ||
13 | #include "unicode/unistr.h" | |
14 | #include "unicode/putil.h" | |
15 | #include "unicode/usearch.h" | |
16 | ||
17 | #include "cmemory.h" | |
18 | #include "unicode/coll.h" | |
19 | #include "unicode/tblcoll.h" | |
20 | #include "unicode/coleitr.h" | |
21 | #include "unicode/ucoleitr.h" | |
22 | ||
23 | #include "unicode/regex.h" // TODO: make conditional on regexp being built. | |
24 | ||
25 | #include "unicode/uniset.h" | |
26 | #include "unicode/uset.h" | |
27 | #include "unicode/ustring.h" | |
28 | #include "hash.h" | |
29 | #include "uhash.h" | |
30 | #include "ucol_imp.h" | |
31 | ||
32 | #include "intltest.h" | |
33 | #include "ssearch.h" | |
34 | ||
35 | #include "unicode/colldata.h" | |
36 | #include "unicode/bmsearch.h" | |
37 | #include "unicode/bms.h" | |
38 | ||
39 | #include "xmlparser.h" | |
40 | #include "ucbuf.h" | |
41 | ||
42 | #include <stdlib.h> | |
43 | #include <string.h> | |
44 | #include <stdio.h> | |
45 | ||
46 | char testId[100]; | |
47 | ||
48 | #define TEST_ASSERT(x) {if (!(x)) { \ | |
49 | errln("Failure in file %s, line %d, test ID = \"%s\"", __FILE__, __LINE__, testId);}} | |
50 | ||
51 | #define TEST_ASSERT_M(x, m) {if (!(x)) { \ | |
52 | errln("Failure in file %s, line %d. \"%s\"", __FILE__, __LINE__, m);return;}} | |
53 | ||
54 | #define TEST_ASSERT_SUCCESS(errcode) {if (U_FAILURE(errcode)) { \ | |
55 | dataerrln("Failure in file %s, line %d, test ID \"%s\", status = \"%s\"", \ | |
56 | __FILE__, __LINE__, testId, u_errorName(errcode));}} | |
57 | ||
58 | #define ARRAY_SIZE(array) (sizeof array / sizeof array[0]) | |
59 | #define NEW_ARRAY(type, count) (type *) uprv_malloc((count) * sizeof(type)) | |
60 | #define DELETE_ARRAY(array) uprv_free((void *) (array)) | |
61 | ||
62 | //--------------------------------------------------------------------------- | |
63 | // | |
64 | // Test class boilerplate | |
65 | // | |
66 | //--------------------------------------------------------------------------- | |
67 | SSearchTest::SSearchTest() | |
68 | { | |
69 | } | |
70 | ||
71 | SSearchTest::~SSearchTest() | |
72 | { | |
73 | } | |
74 | ||
75 | void SSearchTest::runIndexedTest( int32_t index, UBool exec, const char* &name, char *params ) | |
76 | { | |
77 | if (exec) logln("TestSuite SSearchTest: "); | |
78 | switch (index) { | |
79 | #if !UCONFIG_NO_BREAK_ITERATION | |
80 | case 0: name = "searchTest"; | |
81 | if (exec) searchTest(); | |
82 | break; | |
83 | ||
84 | case 1: name = "offsetTest"; | |
85 | if (exec) offsetTest(); | |
86 | break; | |
87 | ||
88 | case 2: name = "monkeyTest"; | |
89 | if (exec) monkeyTest(params); | |
90 | break; | |
91 | ||
92 | case 3: name = "bmMonkeyTest"; | |
93 | if (exec) bmMonkeyTest(params); | |
94 | break; | |
95 | ||
96 | case 4: name = "boyerMooreTest"; | |
97 | if (exec) boyerMooreTest(); | |
98 | break; | |
99 | ||
100 | case 5: name = "goodSuffixTest"; | |
101 | if (exec) goodSuffixTest(); | |
102 | break; | |
103 | ||
104 | case 6: name = "searchTime"; | |
105 | if (exec) searchTime(); | |
106 | break; | |
107 | ||
108 | case 7: name = "bmsTest"; | |
109 | if (exec) bmsTest(); | |
110 | break; | |
111 | ||
112 | case 8: name = "bmSearchTest"; | |
113 | if (exec) bmSearchTest(); | |
114 | break; | |
115 | ||
116 | case 9: name = "udhrTest"; | |
117 | if (exec) udhrTest(); | |
118 | break; | |
119 | case 10: name = "stringListTest"; | |
120 | if (exec) stringListTest(); | |
121 | break; | |
122 | #endif | |
123 | default: name = ""; | |
124 | break; //needed to end loop | |
125 | } | |
126 | } | |
127 | ||
128 | ||
129 | #if !UCONFIG_NO_BREAK_ITERATION | |
130 | ||
131 | #define PATH_BUFFER_SIZE 2048 | |
132 | const char *SSearchTest::getPath(char buffer[2048], const char *filename) { | |
133 | UErrorCode status = U_ZERO_ERROR; | |
134 | const char *testDataDirectory = IntlTest::getSourceTestData(status); | |
135 | ||
136 | if (U_FAILURE(status) || strlen(testDataDirectory) + strlen(filename) + 1 >= PATH_BUFFER_SIZE) { | |
137 | errln("ERROR: getPath() failed - %s", u_errorName(status)); | |
138 | return NULL; | |
139 | } | |
140 | ||
141 | strcpy(buffer, testDataDirectory); | |
142 | strcat(buffer, filename); | |
143 | return buffer; | |
144 | } | |
145 | ||
146 | ||
147 | void SSearchTest::searchTest() | |
148 | { | |
149 | #if !UCONFIG_NO_REGULAR_EXPRESSIONS && !UCONFIG_NO_FILE_IO | |
150 | UErrorCode status = U_ZERO_ERROR; | |
151 | char path[PATH_BUFFER_SIZE]; | |
152 | const char *testFilePath = getPath(path, "ssearch.xml"); | |
153 | ||
154 | if (testFilePath == NULL) { | |
155 | return; /* Couldn't get path: error message already output. */ | |
156 | } | |
157 | ||
158 | LocalPointer<UXMLParser> parser(UXMLParser::createParser(status)); | |
159 | TEST_ASSERT_SUCCESS(status); | |
160 | LocalPointer<UXMLElement> root(parser->parseFile(testFilePath, status)); | |
161 | TEST_ASSERT_SUCCESS(status); | |
162 | if (U_FAILURE(status)) { | |
163 | return; | |
164 | } | |
165 | ||
166 | const UnicodeString *debugTestCase = root->getAttribute("debug"); | |
167 | if (debugTestCase != NULL) { | |
168 | // setenv("USEARCH_DEBUG", "1", 1); | |
169 | } | |
170 | ||
171 | ||
172 | const UXMLElement *testCase; | |
173 | int32_t tc = 0; | |
174 | ||
175 | while((testCase = root->nextChildElement(tc)) != NULL) { | |
176 | ||
177 | if (testCase->getTagName().compare("test-case") != 0) { | |
178 | errln("ssearch, unrecognized XML Element in test file"); | |
179 | continue; | |
180 | } | |
181 | const UnicodeString *id = testCase->getAttribute("id"); | |
182 | *testId = 0; | |
183 | if (id != NULL) { | |
184 | id->extract(0, id->length(), testId, sizeof(testId), US_INV); | |
185 | } | |
186 | ||
187 | // If debugging test case has been specified and this is not it, skip to next. | |
188 | if (id!=NULL && debugTestCase!=NULL && *id != *debugTestCase) { | |
189 | continue; | |
190 | } | |
191 | // | |
192 | // Get the requested collation strength. | |
193 | // Default is tertiary if the XML attribute is missing from the test case. | |
194 | // | |
195 | const UnicodeString *strength = testCase->getAttribute("strength"); | |
196 | UColAttributeValue collatorStrength = UCOL_PRIMARY; | |
197 | if (strength==NULL) { collatorStrength = UCOL_TERTIARY;} | |
198 | else if (*strength=="PRIMARY") { collatorStrength = UCOL_PRIMARY;} | |
199 | else if (*strength=="SECONDARY") { collatorStrength = UCOL_SECONDARY;} | |
200 | else if (*strength=="TERTIARY") { collatorStrength = UCOL_TERTIARY;} | |
201 | else if (*strength=="QUATERNARY") { collatorStrength = UCOL_QUATERNARY;} | |
202 | else if (*strength=="IDENTICAL") { collatorStrength = UCOL_IDENTICAL;} | |
203 | else { | |
204 | // Bogus value supplied for strength. Shouldn't happen, even from | |
205 | // typos, if the XML source has been validated. | |
206 | // This assert is a little deceiving in that strength can be | |
207 | // any of the allowed values, not just TERTIARY, but it will | |
208 | // do the job of getting the error output. | |
209 | TEST_ASSERT(*strength=="TERTIARY") | |
210 | } | |
211 | ||
212 | // | |
213 | // Get the collator normalization flag. Default is UCOL_OFF. | |
214 | // | |
215 | UColAttributeValue normalize = UCOL_OFF; | |
216 | const UnicodeString *norm = testCase->getAttribute("norm"); | |
217 | TEST_ASSERT (norm==NULL || *norm=="ON" || *norm=="OFF"); | |
218 | if (norm!=NULL && *norm=="ON") { | |
219 | normalize = UCOL_ON; | |
220 | } | |
221 | ||
222 | // | |
223 | // Get the alternate_handling flag. Default is UCOL_NON_IGNORABLE. | |
224 | // | |
225 | UColAttributeValue alternateHandling = UCOL_NON_IGNORABLE; | |
226 | const UnicodeString *alt = testCase->getAttribute("alternate_handling"); | |
227 | TEST_ASSERT (alt == NULL || *alt == "SHIFTED" || *alt == "NON_IGNORABLE"); | |
228 | if (alt != NULL && *alt == "SHIFTED") { | |
229 | alternateHandling = UCOL_SHIFTED; | |
230 | } | |
231 | ||
232 | const UnicodeString defLocale("en"); | |
233 | char clocale[100]; | |
234 | const UnicodeString *locale = testCase->getAttribute("locale"); | |
235 | if (locale == NULL || locale->length()==0) { | |
236 | locale = &defLocale; | |
237 | }; | |
238 | locale->extract(0, locale->length(), clocale, sizeof(clocale), NULL); | |
239 | ||
240 | ||
241 | UnicodeString text; | |
242 | UnicodeString target; | |
243 | UnicodeString pattern; | |
244 | int32_t expectedMatchStart = -1; | |
245 | int32_t expectedMatchLimit = -1; | |
246 | const UXMLElement *n; | |
247 | int32_t nodeCount = 0; | |
248 | ||
249 | n = testCase->getChildElement("pattern"); | |
250 | TEST_ASSERT(n != NULL); | |
251 | if (n==NULL) { | |
252 | continue; | |
253 | } | |
254 | text = n->getText(FALSE); | |
255 | text = text.unescape(); | |
256 | pattern.append(text); | |
257 | nodeCount++; | |
258 | ||
259 | n = testCase->getChildElement("pre"); | |
260 | if (n!=NULL) { | |
261 | text = n->getText(FALSE); | |
262 | text = text.unescape(); | |
263 | target.append(text); | |
264 | nodeCount++; | |
265 | } | |
266 | ||
267 | n = testCase->getChildElement("m"); | |
268 | if (n!=NULL) { | |
269 | expectedMatchStart = target.length(); | |
270 | text = n->getText(FALSE); | |
271 | text = text.unescape(); | |
272 | target.append(text); | |
273 | expectedMatchLimit = target.length(); | |
274 | nodeCount++; | |
275 | } | |
276 | ||
277 | n = testCase->getChildElement("post"); | |
278 | if (n!=NULL) { | |
279 | text = n->getText(FALSE); | |
280 | text = text.unescape(); | |
281 | target.append(text); | |
282 | nodeCount++; | |
283 | } | |
284 | ||
285 | // Check that there weren't extra things in the XML | |
286 | TEST_ASSERT(nodeCount == testCase->countChildren()); | |
287 | ||
288 | // Open a collator and StringSearch based on the parameters | |
289 | // obtained from the XML. | |
290 | // | |
291 | status = U_ZERO_ERROR; | |
292 | LocalUCollatorPointer collator(ucol_open(clocale, &status)); | |
293 | ucol_setStrength(collator.getAlias(), collatorStrength); | |
294 | ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status); | |
295 | ucol_setAttribute(collator.getAlias(), UCOL_ALTERNATE_HANDLING, alternateHandling, &status); | |
296 | LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(), | |
297 | target.getBuffer(), target.length(), | |
298 | collator.getAlias(), | |
299 | NULL, // the break iterator | |
300 | &status)); | |
301 | ||
302 | TEST_ASSERT_SUCCESS(status); | |
303 | if (U_FAILURE(status)) { | |
304 | continue; | |
305 | } | |
306 | ||
307 | int32_t foundStart = 0; | |
308 | int32_t foundLimit = 0; | |
309 | UBool foundMatch; | |
310 | ||
311 | // | |
312 | // Do the search, check the match result against the expected results. | |
313 | // | |
314 | foundMatch= usearch_search(uss.getAlias(), 0, &foundStart, &foundLimit, &status); | |
315 | TEST_ASSERT_SUCCESS(status); | |
316 | if ((foundMatch && expectedMatchStart<0) || | |
317 | (foundStart != expectedMatchStart) || | |
318 | (foundLimit != expectedMatchLimit)) { | |
319 | TEST_ASSERT(FALSE); // ouput generic error position | |
320 | infoln("Found, expected match start = %d, %d \n" | |
321 | "Found, expected match limit = %d, %d", | |
322 | foundStart, expectedMatchStart, foundLimit, expectedMatchLimit); | |
323 | } | |
324 | ||
325 | // In case there are other matches... | |
326 | // (should we only do this if the test case passed?) | |
327 | while (foundMatch) { | |
328 | expectedMatchStart = foundStart; | |
329 | expectedMatchLimit = foundLimit; | |
330 | ||
331 | foundMatch = usearch_search(uss.getAlias(), foundLimit, &foundStart, &foundLimit, &status); | |
332 | } | |
333 | ||
334 | uss.adoptInstead(usearch_openFromCollator(pattern.getBuffer(), pattern.length(), | |
335 | target.getBuffer(), target.length(), | |
336 | collator.getAlias(), | |
337 | NULL, | |
338 | &status)); | |
339 | ||
340 | // | |
341 | // Do the backwards search, check the match result against the expected results. | |
342 | // | |
343 | foundMatch= usearch_searchBackwards(uss.getAlias(), target.length(), &foundStart, &foundLimit, &status); | |
344 | TEST_ASSERT_SUCCESS(status); | |
345 | if ((foundMatch && expectedMatchStart<0) || | |
346 | (foundStart != expectedMatchStart) || | |
347 | (foundLimit != expectedMatchLimit)) { | |
348 | TEST_ASSERT(FALSE); // ouput generic error position | |
349 | infoln("Found, expected backwards match start = %d, %d \n" | |
350 | "Found, expected backwards match limit = %d, %d", | |
351 | foundStart, expectedMatchStart, foundLimit, expectedMatchLimit); | |
352 | } | |
353 | } | |
354 | #endif | |
355 | } | |
356 | ||
357 | struct UdhrTestCase | |
358 | { | |
359 | const char *locale; | |
360 | const char *file; | |
361 | }; | |
362 | ||
363 | void SSearchTest::udhrTest() | |
364 | { | |
365 | UErrorCode status = U_ZERO_ERROR; | |
366 | char path[PATH_BUFFER_SIZE]; | |
367 | const char *udhrPath = getPath(path, "udhr"); | |
368 | ||
369 | if (udhrPath == NULL) { | |
370 | // couldn't get path: error message already output... | |
371 | return; | |
372 | } | |
373 | ||
374 | UdhrTestCase testCases[] = { | |
375 | {"en", "udhr_eng.txt"}, | |
376 | {"de", "udhr_deu_1996.txt"}, | |
377 | {"fr", "udhr_fra.txt"}, | |
378 | {"ru", "udhr_rus.txt"}, | |
379 | {"th", "udhr_tha.txt"}, | |
380 | {"ja", "udhr_jpn.txt"}, | |
381 | {"ko", "udhr_kor.txt"}, | |
382 | {"zh", "udhr_cmn_hans.txt"}, | |
383 | {"zh_Hant", "udhr_cmn_hant.txt"} | |
384 | }; | |
385 | ||
386 | int32_t testCount = ARRAY_SIZE(testCases); | |
387 | ||
388 | for (int32_t t = 0; t < testCount; t += 1) { | |
389 | int32_t len = 0; | |
390 | char *resolvedFileName = NULL; | |
391 | const char *encoding = NULL; | |
392 | UCHARBUF *ucharBuf = NULL; | |
393 | ||
394 | ucbuf_resolveFileName(udhrPath, testCases[t].file, NULL, &len, &status); | |
395 | resolvedFileName = NEW_ARRAY(char, len); | |
396 | ||
397 | if(resolvedFileName == NULL){ | |
398 | continue; | |
399 | } | |
400 | ||
401 | if(status == U_BUFFER_OVERFLOW_ERROR){ | |
402 | status = U_ZERO_ERROR; | |
403 | } | |
404 | ||
405 | ucbuf_resolveFileName(udhrPath, testCases[t].file, resolvedFileName, &len, &status); | |
406 | ucharBuf = ucbuf_open(resolvedFileName, &encoding, TRUE, FALSE, &status); | |
407 | ||
408 | DELETE_ARRAY(resolvedFileName); | |
409 | ||
410 | if(U_FAILURE(status)){ | |
411 | infoln("Could not open the input file %s. Test skipped\n", testCases[t].file); | |
412 | continue; | |
413 | } | |
414 | ||
415 | int32_t targetLen = 0; | |
416 | const UChar *target = ucbuf_getBuffer(ucharBuf, &targetLen, &status); | |
417 | ||
418 | /* The first line of the file contains the pattern */ | |
419 | int32_t start = 0, end = 0, plen = 0; | |
420 | ||
421 | for(end = start; ; end += 1) { | |
422 | UChar ch = target[end]; | |
423 | ||
424 | if (ch == 0x000A || ch == 0x000D || ch == 0x2028) { | |
425 | break; | |
426 | } | |
427 | } | |
428 | ||
429 | plen = end - start; | |
430 | ||
431 | UChar *pattern = NEW_ARRAY(UChar, plen); | |
432 | for (int32_t i = 0; i < plen; i += 1) { | |
433 | pattern[i] = target[start++]; | |
434 | } | |
435 | ||
436 | int32_t offset = 0; | |
437 | UCollator *coll = ucol_open(testCases[t].locale, &status); | |
438 | UCD *ucd = NULL; | |
439 | BMS *bms = NULL; | |
440 | ||
441 | if (U_FAILURE(status)) { | |
442 | errln("Could not open collator for %s", testCases[t].locale); | |
443 | goto delete_collator; | |
444 | } | |
445 | ||
446 | ucd = ucd_open(coll, &status); | |
447 | ||
448 | if (U_FAILURE(status)) { | |
449 | errln("Could not open CollData object for %s", testCases[t].locale); | |
450 | goto delete_ucd; | |
451 | } | |
452 | ||
453 | bms = bms_open(ucd, pattern, plen, target, targetLen, &status); | |
454 | ||
455 | if (U_FAILURE(status)) { | |
456 | errln("Could not open search object for %s", testCases[t].locale); | |
457 | goto delete_bms; | |
458 | } | |
459 | ||
460 | start = end = -1; | |
461 | while (bms_search(bms, offset, &start, &end)) { | |
462 | offset = end; | |
463 | } | |
464 | ||
465 | if (offset == 0) { | |
466 | errln("Could not find pattern - locale: %s, file: %s ", testCases[t].locale, testCases[t].file); | |
467 | } | |
468 | ||
469 | delete_bms: | |
470 | bms_close(bms); | |
471 | ||
472 | delete_ucd: | |
473 | ucd_close(ucd); | |
474 | ||
475 | delete_collator: | |
476 | ucol_close(coll); | |
477 | ||
478 | DELETE_ARRAY(pattern); | |
479 | ucbuf_close(ucharBuf); | |
480 | } | |
481 | ||
482 | ucd_flushCache(); | |
483 | } | |
484 | ||
485 | void SSearchTest::bmSearchTest() | |
486 | { | |
487 | #if !UCONFIG_NO_REGULAR_EXPRESSIONS | |
488 | UErrorCode status = U_ZERO_ERROR; | |
489 | char path[PATH_BUFFER_SIZE]; | |
490 | const char *testFilePath = getPath(path, "ssearch.xml"); | |
491 | ||
492 | if (testFilePath == NULL) { | |
493 | return; /* Couldn't get path: error message already output. */ | |
494 | } | |
495 | ||
496 | UXMLParser *parser = UXMLParser::createParser(status); | |
497 | TEST_ASSERT_SUCCESS(status); | |
498 | UXMLElement *root = parser->parseFile(testFilePath, status); | |
499 | TEST_ASSERT_SUCCESS(status); | |
500 | if (U_FAILURE(status)) { | |
501 | return; | |
502 | } | |
503 | ||
504 | const UnicodeString *debugTestCase = root->getAttribute("debug"); | |
505 | if (debugTestCase != NULL) { | |
506 | // setenv("USEARCH_DEBUG", "1", 1); | |
507 | } | |
508 | ||
509 | ||
510 | const UXMLElement *testCase; | |
511 | int32_t tc = 0; | |
512 | ||
513 | while((testCase = root->nextChildElement(tc)) != NULL) { | |
514 | ||
515 | if (testCase->getTagName().compare("test-case") != 0) { | |
516 | errln("ssearch, unrecognized XML Element in test file"); | |
517 | continue; | |
518 | } | |
519 | const UnicodeString *id = testCase->getAttribute("id"); | |
520 | *testId = 0; | |
521 | if (id != NULL) { | |
522 | id->extract(0, id->length(), testId, sizeof(testId), US_INV); | |
523 | } | |
524 | ||
525 | // If debugging test case has been specified and this is not it, skip to next. | |
526 | if (id!=NULL && debugTestCase!=NULL && *id != *debugTestCase) { | |
527 | continue; | |
528 | } | |
529 | // | |
530 | // Get the requested collation strength. | |
531 | // Default is tertiary if the XML attribute is missing from the test case. | |
532 | // | |
533 | const UnicodeString *strength = testCase->getAttribute("strength"); | |
534 | UColAttributeValue collatorStrength = UCOL_PRIMARY; | |
535 | if (strength==NULL) { collatorStrength = UCOL_TERTIARY;} | |
536 | else if (*strength=="PRIMARY") { collatorStrength = UCOL_PRIMARY;} | |
537 | else if (*strength=="SECONDARY") { collatorStrength = UCOL_SECONDARY;} | |
538 | else if (*strength=="TERTIARY") { collatorStrength = UCOL_TERTIARY;} | |
539 | else if (*strength=="QUATERNARY") { collatorStrength = UCOL_QUATERNARY;} | |
540 | else if (*strength=="IDENTICAL") { collatorStrength = UCOL_IDENTICAL;} | |
541 | else { | |
542 | // Bogus value supplied for strength. Shouldn't happen, even from | |
543 | // typos, if the XML source has been validated. | |
544 | // This assert is a little deceiving in that strength can be | |
545 | // any of the allowed values, not just TERTIARY, but it will | |
546 | // do the job of getting the error output. | |
547 | TEST_ASSERT(*strength=="TERTIARY") | |
548 | } | |
549 | ||
550 | // | |
551 | // Get the collator normalization flag. Default is UCOL_OFF. | |
552 | // | |
553 | UColAttributeValue normalize = UCOL_OFF; | |
554 | const UnicodeString *norm = testCase->getAttribute("norm"); | |
555 | TEST_ASSERT (norm==NULL || *norm=="ON" || *norm=="OFF"); | |
556 | if (norm!=NULL && *norm=="ON") { | |
557 | normalize = UCOL_ON; | |
558 | } | |
559 | ||
560 | // | |
561 | // Get the alternate_handling flag. Default is UCOL_NON_IGNORABLE. | |
562 | // | |
563 | UColAttributeValue alternateHandling = UCOL_NON_IGNORABLE; | |
564 | const UnicodeString *alt = testCase->getAttribute("alternate_handling"); | |
565 | TEST_ASSERT (alt == NULL || *alt == "SHIFTED" || *alt == "NON_IGNORABLE"); | |
566 | if (alt != NULL && *alt == "SHIFTED") { | |
567 | alternateHandling = UCOL_SHIFTED; | |
568 | } | |
569 | ||
570 | const UnicodeString defLocale("en"); | |
571 | char clocale[100]; | |
572 | const UnicodeString *locale = testCase->getAttribute("locale"); | |
573 | if (locale == NULL || locale->length()==0) { | |
574 | locale = &defLocale; | |
575 | }; | |
576 | locale->extract(0, locale->length(), clocale, sizeof(clocale), NULL); | |
577 | ||
578 | ||
579 | UnicodeString text; | |
580 | UnicodeString target; | |
581 | UnicodeString pattern; | |
582 | int32_t expectedMatchStart = -1; | |
583 | int32_t expectedMatchLimit = -1; | |
584 | const UXMLElement *n; | |
585 | int32_t nodeCount = 0; | |
586 | ||
587 | n = testCase->getChildElement("pattern"); | |
588 | TEST_ASSERT(n != NULL); | |
589 | if (n==NULL) { | |
590 | continue; | |
591 | } | |
592 | text = n->getText(FALSE); | |
593 | text = text.unescape(); | |
594 | pattern.append(text); | |
595 | nodeCount++; | |
596 | ||
597 | n = testCase->getChildElement("pre"); | |
598 | if (n!=NULL) { | |
599 | text = n->getText(FALSE); | |
600 | text = text.unescape(); | |
601 | target.append(text); | |
602 | nodeCount++; | |
603 | } | |
604 | ||
605 | n = testCase->getChildElement("m"); | |
606 | if (n!=NULL) { | |
607 | expectedMatchStart = target.length(); | |
608 | text = n->getText(FALSE); | |
609 | text = text.unescape(); | |
610 | target.append(text); | |
611 | expectedMatchLimit = target.length(); | |
612 | nodeCount++; | |
613 | } | |
614 | ||
615 | n = testCase->getChildElement("post"); | |
616 | if (n!=NULL) { | |
617 | text = n->getText(FALSE); | |
618 | text = text.unescape(); | |
619 | target.append(text); | |
620 | nodeCount++; | |
621 | } | |
622 | ||
623 | // Check that there weren't extra things in the XML | |
624 | TEST_ASSERT(nodeCount == testCase->countChildren()); | |
625 | ||
626 | // Open a collator and StringSearch based on the parameters | |
627 | // obtained from the XML. | |
628 | // | |
629 | status = U_ZERO_ERROR; | |
630 | UCollator *collator = ucol_open(clocale, &status); | |
631 | ucol_setStrength(collator, collatorStrength); | |
632 | ucol_setAttribute(collator, UCOL_NORMALIZATION_MODE, normalize, &status); | |
633 | ucol_setAttribute(collator, UCOL_ALTERNATE_HANDLING, alternateHandling, &status); | |
634 | UCD *ucd = ucd_open(collator, &status); | |
635 | BMS *bms = bms_open(ucd, pattern.getBuffer(), pattern.length(), target.getBuffer(), target.length(), &status); | |
636 | ||
637 | TEST_ASSERT_SUCCESS(status); | |
638 | if (U_FAILURE(status)) { | |
639 | bms_close(bms); | |
640 | ucd_close(ucd); | |
641 | ucol_close(collator); | |
642 | continue; | |
643 | } | |
644 | ||
645 | int32_t foundStart = 0; | |
646 | int32_t foundLimit = 0; | |
647 | UBool foundMatch; | |
648 | ||
649 | // | |
650 | // Do the search, check the match result against the expected results. | |
651 | // | |
652 | foundMatch = bms_search(bms, 0, &foundStart, &foundLimit); | |
653 | //TEST_ASSERT_SUCCESS(status); | |
654 | if ((foundMatch && expectedMatchStart < 0) || | |
655 | (foundStart != expectedMatchStart) || | |
656 | (foundLimit != expectedMatchLimit)) { | |
657 | TEST_ASSERT(FALSE); // ouput generic error position | |
658 | infoln("Found, expected match start = %d, %d \n" | |
659 | "Found, expected match limit = %d, %d", | |
660 | foundStart, expectedMatchStart, foundLimit, expectedMatchLimit); | |
661 | } | |
662 | ||
663 | bms_close(bms); | |
664 | ucd_close(ucd); | |
665 | ucol_close(collator); | |
666 | } | |
667 | ||
668 | ucd_flushCache(); | |
669 | delete root; | |
670 | delete parser; | |
671 | #endif | |
672 | } | |
673 | ||
674 | struct Order | |
675 | { | |
676 | int32_t order; | |
677 | int32_t lowOffset; | |
678 | int32_t highOffset; | |
679 | }; | |
680 | ||
681 | class OrderList | |
682 | { | |
683 | public: | |
684 | OrderList(); | |
685 | OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset = 0); | |
686 | ~OrderList(); | |
687 | ||
688 | int32_t size(void) const; | |
689 | void add(int32_t order, int32_t low, int32_t high); | |
690 | const Order *get(int32_t index) const; | |
691 | int32_t getLowOffset(int32_t index) const; | |
692 | int32_t getHighOffset(int32_t index) const; | |
693 | int32_t getOrder(int32_t index) const; | |
694 | void reverse(void); | |
695 | UBool compare(const OrderList &other) const; | |
696 | UBool matchesAt(int32_t offset, const OrderList &other) const; | |
697 | ||
698 | private: | |
699 | Order *list; | |
700 | int32_t listMax; | |
701 | int32_t listSize; | |
702 | }; | |
703 | ||
704 | OrderList::OrderList() | |
705 | : list(NULL), listMax(16), listSize(0) | |
706 | { | |
707 | list = new Order[listMax]; | |
708 | } | |
709 | ||
710 | OrderList::OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset) | |
711 | : list(NULL), listMax(16), listSize(0) | |
712 | { | |
713 | UErrorCode status = U_ZERO_ERROR; | |
714 | UCollationElements *elems = ucol_openElements(coll, string.getBuffer(), string.length(), &status); | |
715 | uint32_t strengthMask = 0; | |
716 | int32_t order, low, high; | |
717 | ||
718 | switch (ucol_getStrength(coll)) | |
719 | { | |
720 | default: | |
721 | strengthMask |= UCOL_TERTIARYORDERMASK; | |
722 | /* fall through */ | |
723 | ||
724 | case UCOL_SECONDARY: | |
725 | strengthMask |= UCOL_SECONDARYORDERMASK; | |
726 | /* fall through */ | |
727 | ||
728 | case UCOL_PRIMARY: | |
729 | strengthMask |= UCOL_PRIMARYORDERMASK; | |
730 | } | |
731 | ||
732 | list = new Order[listMax]; | |
733 | ||
734 | ucol_setOffset(elems, stringOffset, &status); | |
735 | ||
736 | do { | |
737 | low = ucol_getOffset(elems); | |
738 | order = ucol_next(elems, &status); | |
739 | high = ucol_getOffset(elems); | |
740 | ||
741 | if (order != UCOL_NULLORDER) { | |
742 | order &= strengthMask; | |
743 | } | |
744 | ||
745 | if (order != UCOL_IGNORABLE) { | |
746 | add(order, low, high); | |
747 | } | |
748 | } while (order != UCOL_NULLORDER); | |
749 | ||
750 | ucol_closeElements(elems); | |
751 | } | |
752 | ||
753 | OrderList::~OrderList() | |
754 | { | |
755 | delete[] list; | |
756 | } | |
757 | ||
758 | void OrderList::add(int32_t order, int32_t low, int32_t high) | |
759 | { | |
760 | if (listSize >= listMax) { | |
761 | listMax *= 2; | |
762 | ||
763 | Order *newList = new Order[listMax]; | |
764 | ||
765 | uprv_memcpy(newList, list, listSize * sizeof(Order)); | |
766 | delete[] list; | |
767 | list = newList; | |
768 | } | |
769 | ||
770 | list[listSize].order = order; | |
771 | list[listSize].lowOffset = low; | |
772 | list[listSize].highOffset = high; | |
773 | ||
774 | listSize += 1; | |
775 | } | |
776 | ||
777 | const Order *OrderList::get(int32_t index) const | |
778 | { | |
779 | if (index >= listSize) { | |
780 | return NULL; | |
781 | } | |
782 | ||
783 | return &list[index]; | |
784 | } | |
785 | ||
786 | int32_t OrderList::getLowOffset(int32_t index) const | |
787 | { | |
788 | const Order *order = get(index); | |
789 | ||
790 | if (order != NULL) { | |
791 | return order->lowOffset; | |
792 | } | |
793 | ||
794 | return -1; | |
795 | } | |
796 | ||
797 | int32_t OrderList::getHighOffset(int32_t index) const | |
798 | { | |
799 | const Order *order = get(index); | |
800 | ||
801 | if (order != NULL) { | |
802 | return order->highOffset; | |
803 | } | |
804 | ||
805 | return -1; | |
806 | } | |
807 | ||
808 | int32_t OrderList::getOrder(int32_t index) const | |
809 | { | |
810 | const Order *order = get(index); | |
811 | ||
812 | if (order != NULL) { | |
813 | return order->order; | |
814 | } | |
815 | ||
816 | return UCOL_NULLORDER; | |
817 | } | |
818 | ||
819 | int32_t OrderList::size() const | |
820 | { | |
821 | return listSize; | |
822 | } | |
823 | ||
824 | void OrderList::reverse() | |
825 | { | |
826 | for(int32_t f = 0, b = listSize - 1; f < b; f += 1, b -= 1) { | |
827 | Order swap = list[b]; | |
828 | ||
829 | list[b] = list[f]; | |
830 | list[f] = swap; | |
831 | } | |
832 | } | |
833 | ||
834 | UBool OrderList::compare(const OrderList &other) const | |
835 | { | |
836 | if (listSize != other.listSize) { | |
837 | return FALSE; | |
838 | } | |
839 | ||
840 | for(int32_t i = 0; i < listSize; i += 1) { | |
841 | if (list[i].order != other.list[i].order || | |
842 | list[i].lowOffset != other.list[i].lowOffset || | |
843 | list[i].highOffset != other.list[i].highOffset) { | |
844 | return FALSE; | |
845 | } | |
846 | } | |
847 | ||
848 | return TRUE; | |
849 | } | |
850 | ||
851 | UBool OrderList::matchesAt(int32_t offset, const OrderList &other) const | |
852 | { | |
853 | // NOTE: sizes include the NULLORDER, which we don't want to compare. | |
854 | int32_t otherSize = other.size() - 1; | |
855 | ||
856 | if (listSize - 1 - offset < otherSize) { | |
857 | return FALSE; | |
858 | } | |
859 | ||
860 | for (int32_t i = offset, j = 0; j < otherSize; i += 1, j += 1) { | |
861 | if (getOrder(i) != other.getOrder(j)) { | |
862 | return FALSE; | |
863 | } | |
864 | } | |
865 | ||
866 | return TRUE; | |
867 | } | |
868 | ||
869 | static char *printOffsets(char *buffer, OrderList &list) | |
870 | { | |
871 | int32_t size = list.size(); | |
872 | char *s = buffer; | |
873 | ||
874 | for(int32_t i = 0; i < size; i += 1) { | |
875 | const Order *order = list.get(i); | |
876 | ||
877 | if (i != 0) { | |
878 | s += sprintf(s, ", "); | |
879 | } | |
880 | ||
881 | s += sprintf(s, "(%d, %d)", order->lowOffset, order->highOffset); | |
882 | } | |
883 | ||
884 | return buffer; | |
885 | } | |
886 | ||
887 | static char *printOrders(char *buffer, OrderList &list) | |
888 | { | |
889 | int32_t size = list.size(); | |
890 | char *s = buffer; | |
891 | ||
892 | for(int32_t i = 0; i < size; i += 1) { | |
893 | const Order *order = list.get(i); | |
894 | ||
895 | if (i != 0) { | |
896 | s += sprintf(s, ", "); | |
897 | } | |
898 | ||
899 | s += sprintf(s, "%8.8X", order->order); | |
900 | } | |
901 | ||
902 | return buffer; | |
903 | } | |
904 | ||
905 | void SSearchTest::offsetTest() | |
906 | { | |
907 | static const UVersionInfo icu47 = { 4, 7, 0, 0 }; | |
908 | const char *test[] = { | |
909 | // The sequence \u0FB3\u0F71\u0F71\u0F80 contains a discontiguous | |
910 | // contraction (\u0FB3\u0F71\u0F80) logically followed by \u0F71. | |
911 | "\\u1E33\\u0FB3\\u0F71\\u0F71\\u0F80\\uD835\\uDF6C\\u01B0", | |
912 | ||
913 | "\\ua191\\u16ef\\u2036\\u017a", | |
914 | ||
915 | #if 0 | |
916 | // This results in a complex interaction between contraction, | |
917 | // expansion and normalization that confuses the backwards offset fixups. | |
918 | "\\u0F7F\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85", | |
919 | #endif | |
920 | ||
921 | "\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85", | |
922 | "\\u07E9\\u07EA\\u07F1\\u07F2\\u07F3", | |
923 | ||
924 | "\\u02FE\\u02FF" | |
925 | "\\u0300\\u0301\\u0302\\u0303\\u0304\\u0305\\u0306\\u0307\\u0308\\u0309\\u030A\\u030B\\u030C\\u030D\\u030E\\u030F" | |
926 | "\\u0310\\u0311\\u0312\\u0313\\u0314\\u0315\\u0316\\u0317\\u0318\\u0319\\u031A\\u031B\\u031C\\u031D\\u031E\\u031F" | |
927 | "\\u0320\\u0321\\u0322\\u0323\\u0324\\u0325\\u0326\\u0327\\u0328\\u0329\\u032A\\u032B\\u032C\\u032D\\u032E\\u032F" | |
928 | "\\u0330\\u0331\\u0332\\u0333\\u0334\\u0335\\u0336\\u0337\\u0338\\u0339\\u033A\\u033B\\u033C\\u033D\\u033E\\u033F" | |
929 | "\\u0340\\u0341\\u0342\\u0343\\u0344\\u0345\\u0346\\u0347\\u0348\\u0349\\u034A\\u034B\\u034C\\u034D\\u034E", // currently not working, see #8081 | |
930 | ||
931 | "\\u02FE\\u02FF\\u0300\\u0301\\u0302\\u0303\\u0316\\u0317\\u0318", // currently not working, see #8081 | |
932 | "a\\u02FF\\u0301\\u0316", // currently not working, see #8081 | |
933 | "a\\u02FF\\u0316\\u0301", | |
934 | "a\\u0430\\u0301\\u0316", | |
935 | "a\\u0430\\u0316\\u0301", | |
936 | "abc\\u0E41\\u0301\\u0316", | |
937 | "abc\\u0E41\\u0316\\u0301", | |
938 | "\\u0E41\\u0301\\u0316", | |
939 | "\\u0E41\\u0316\\u0301", | |
940 | "a\\u0301\\u0316", | |
941 | "a\\u0316\\u0301", | |
942 | "\\uAC52\\uAC53", | |
943 | "\\u34CA\\u34CB", | |
944 | "\\u11ED\\u11EE", | |
945 | "\\u30C3\\u30D0", | |
946 | "p\\u00E9ch\\u00E9", | |
947 | "a\\u0301\\u0325", | |
948 | "a\\u0300\\u0325", | |
949 | "a\\u0325\\u0300", | |
950 | "A\\u0323\\u0300B", | |
951 | "A\\u0300\\u0323B", | |
952 | "A\\u0301\\u0323B", | |
953 | "A\\u0302\\u0301\\u0323B", | |
954 | "abc", | |
955 | "ab\\u0300c", | |
956 | "ab\\u0300\\u0323c", | |
957 | " \\uD800\\uDC00\\uDC00", | |
958 | "a\\uD800\\uDC00\\uDC00", | |
959 | "A\\u0301\\u0301", | |
960 | "A\\u0301\\u0323", | |
961 | "A\\u0301\\u0323B", | |
962 | "B\\u0301\\u0323C", | |
963 | "A\\u0300\\u0323B", | |
964 | "\\u0301A\\u0301\\u0301", | |
965 | "abcd\\r\\u0301", | |
966 | "p\\u00EAche", | |
967 | "pe\\u0302che", | |
968 | }; | |
969 | ||
970 | int32_t testCount = ARRAY_SIZE(test); | |
971 | UErrorCode status = U_ZERO_ERROR; | |
972 | RuleBasedCollator *col = (RuleBasedCollator *) Collator::createInstance(Locale::getEnglish(), status); | |
973 | if (U_FAILURE(status)) { | |
974 | errcheckln(status, "Failed to create collator in offsetTest! - %s", u_errorName(status)); | |
975 | return; | |
976 | } | |
977 | char buffer[4096]; // A bit of a hack... just happens to be long enough for all the test cases... | |
978 | // We could allocate one that's the right size by (CE_count * 10) + 2 | |
979 | // 10 chars is enough room for 8 hex digits plus ", ". 2 extra chars for "[" and "]" | |
980 | ||
981 | col->setAttribute(UCOL_NORMALIZATION_MODE, UCOL_ON, status); | |
982 | ||
983 | for(int32_t i = 0; i < testCount; i += 1) { | |
984 | if (!isICUVersionAtLeast(icu47) && i>=4 && i<=6) { | |
985 | continue; // timebomb until ticket #8080 is resolved | |
986 | } | |
987 | UnicodeString ts = CharsToUnicodeString(test[i]); | |
988 | CollationElementIterator *iter = col->createCollationElementIterator(ts); | |
989 | OrderList forwardList; | |
990 | OrderList backwardList; | |
991 | int32_t order, low, high; | |
992 | ||
993 | do { | |
994 | low = iter->getOffset(); | |
995 | order = iter->next(status); | |
996 | high = iter->getOffset(); | |
997 | ||
998 | forwardList.add(order, low, high); | |
999 | } while (order != CollationElementIterator::NULLORDER); | |
1000 | ||
1001 | iter->reset(); | |
1002 | iter->setOffset(ts.length(), status); | |
1003 | ||
1004 | backwardList.add(CollationElementIterator::NULLORDER, iter->getOffset(), iter->getOffset()); | |
1005 | ||
1006 | do { | |
1007 | high = iter->getOffset(); | |
1008 | order = iter->previous(status); | |
1009 | low = iter->getOffset(); | |
1010 | ||
1011 | if (order == CollationElementIterator::NULLORDER) { | |
1012 | break; | |
1013 | } | |
1014 | ||
1015 | backwardList.add(order, low, high); | |
1016 | } while (TRUE); | |
1017 | ||
1018 | backwardList.reverse(); | |
1019 | ||
1020 | if (forwardList.compare(backwardList)) { | |
1021 | logln("Works with \"%s\"", test[i]); | |
1022 | logln("Forward offsets: [%s]", printOffsets(buffer, forwardList)); | |
1023 | // logln("Backward offsets: [%s]", printOffsets(buffer, backwardList)); | |
1024 | ||
1025 | logln("Forward CEs: [%s]", printOrders(buffer, forwardList)); | |
1026 | // logln("Backward CEs: [%s]", printOrders(buffer, backwardList)); | |
1027 | ||
1028 | logln(); | |
1029 | } else { | |
1030 | errln("Fails with \"%s\"", test[i]); | |
1031 | infoln("Forward offsets: [%s]", printOffsets(buffer, forwardList)); | |
1032 | infoln("Backward offsets: [%s]", printOffsets(buffer, backwardList)); | |
1033 | ||
1034 | infoln("Forward CEs: [%s]", printOrders(buffer, forwardList)); | |
1035 | infoln("Backward CEs: [%s]", printOrders(buffer, backwardList)); | |
1036 | ||
1037 | infoln(); | |
1038 | } | |
1039 | delete iter; | |
1040 | } | |
1041 | delete col; | |
1042 | } | |
1043 | ||
1044 | #if 0 | |
1045 | static UnicodeString &escape(const UnicodeString &string, UnicodeString &buffer) | |
1046 | { | |
1047 | for(int32_t i = 0; i < string.length(); i += 1) { | |
1048 | UChar32 ch = string.char32At(i); | |
1049 | ||
1050 | if (ch >= 0x0020 && ch <= 0x007F) { | |
1051 | if (ch == 0x005C) { | |
1052 | buffer.append("\\\\"); | |
1053 | } else { | |
1054 | buffer.append(ch); | |
1055 | } | |
1056 | } else { | |
1057 | char cbuffer[12]; | |
1058 | ||
1059 | if (ch <= 0xFFFFL) { | |
1060 | sprintf(cbuffer, "\\u%4.4X", ch); | |
1061 | } else { | |
1062 | sprintf(cbuffer, "\\U%8.8X", ch); | |
1063 | } | |
1064 | ||
1065 | buffer.append(cbuffer); | |
1066 | } | |
1067 | ||
1068 | if (ch >= 0x10000L) { | |
1069 | i += 1; | |
1070 | } | |
1071 | } | |
1072 | ||
1073 | return buffer; | |
1074 | } | |
1075 | #endif | |
1076 | ||
1077 | #if 1 | |
1078 | ||
1079 | struct PCE | |
1080 | { | |
1081 | uint64_t ce; | |
1082 | int32_t lowOffset; | |
1083 | int32_t highOffset; | |
1084 | }; | |
1085 | ||
1086 | class PCEList | |
1087 | { | |
1088 | public: | |
1089 | PCEList(UCollator *coll, const UnicodeString &string); | |
1090 | ~PCEList(); | |
1091 | ||
1092 | int32_t size() const; | |
1093 | ||
1094 | const PCE *get(int32_t index) const; | |
1095 | ||
1096 | int32_t getLowOffset(int32_t index) const; | |
1097 | int32_t getHighOffset(int32_t index) const; | |
1098 | uint64_t getOrder(int32_t index) const; | |
1099 | ||
1100 | UBool matchesAt(int32_t offset, const PCEList &other) const; | |
1101 | ||
1102 | uint64_t operator[](int32_t index) const; | |
1103 | ||
1104 | private: | |
1105 | void add(uint64_t ce, int32_t low, int32_t high); | |
1106 | ||
1107 | PCE *list; | |
1108 | int32_t listMax; | |
1109 | int32_t listSize; | |
1110 | }; | |
1111 | ||
1112 | PCEList::PCEList(UCollator *coll, const UnicodeString &string) | |
1113 | { | |
1114 | UErrorCode status = U_ZERO_ERROR; | |
1115 | UCollationElements *elems = ucol_openElements(coll, string.getBuffer(), string.length(), &status); | |
1116 | uint64_t order; | |
1117 | int32_t low, high; | |
1118 | ||
1119 | list = new PCE[listMax]; | |
1120 | ||
1121 | ucol_setOffset(elems, 0, &status); | |
1122 | ||
1123 | do { | |
1124 | order = ucol_nextProcessed(elems, &low, &high, &status); | |
1125 | add(order, low, high); | |
1126 | } while (order != UCOL_PROCESSED_NULLORDER); | |
1127 | ||
1128 | ucol_closeElements(elems); | |
1129 | } | |
1130 | ||
1131 | PCEList::~PCEList() | |
1132 | { | |
1133 | delete[] list; | |
1134 | } | |
1135 | ||
1136 | void PCEList::add(uint64_t order, int32_t low, int32_t high) | |
1137 | { | |
1138 | if (listSize >= listMax) { | |
1139 | listMax *= 2; | |
1140 | ||
1141 | PCE *newList = new PCE[listMax]; | |
1142 | ||
1143 | uprv_memcpy(newList, list, listSize * sizeof(Order)); | |
1144 | delete[] list; | |
1145 | list = newList; | |
1146 | } | |
1147 | ||
1148 | list[listSize].ce = order; | |
1149 | list[listSize].lowOffset = low; | |
1150 | list[listSize].highOffset = high; | |
1151 | ||
1152 | listSize += 1; | |
1153 | } | |
1154 | ||
1155 | const PCE *PCEList::get(int32_t index) const | |
1156 | { | |
1157 | if (index >= listSize) { | |
1158 | return NULL; | |
1159 | } | |
1160 | ||
1161 | return &list[index]; | |
1162 | } | |
1163 | ||
1164 | int32_t PCEList::getLowOffset(int32_t index) const | |
1165 | { | |
1166 | const PCE *pce = get(index); | |
1167 | ||
1168 | if (pce != NULL) { | |
1169 | return pce->lowOffset; | |
1170 | } | |
1171 | ||
1172 | return -1; | |
1173 | } | |
1174 | ||
1175 | int32_t PCEList::getHighOffset(int32_t index) const | |
1176 | { | |
1177 | const PCE *pce = get(index); | |
1178 | ||
1179 | if (pce != NULL) { | |
1180 | return pce->highOffset; | |
1181 | } | |
1182 | ||
1183 | return -1; | |
1184 | } | |
1185 | ||
1186 | uint64_t PCEList::getOrder(int32_t index) const | |
1187 | { | |
1188 | const PCE *pce = get(index); | |
1189 | ||
1190 | if (pce != NULL) { | |
1191 | return pce->ce; | |
1192 | } | |
1193 | ||
1194 | return UCOL_PROCESSED_NULLORDER; | |
1195 | } | |
1196 | ||
1197 | int32_t PCEList::size() const | |
1198 | { | |
1199 | return listSize; | |
1200 | } | |
1201 | ||
1202 | UBool PCEList::matchesAt(int32_t offset, const PCEList &other) const | |
1203 | { | |
1204 | // NOTE: sizes include the NULLORDER, which we don't want to compare. | |
1205 | int32_t otherSize = other.size() - 1; | |
1206 | ||
1207 | if (listSize - 1 - offset < otherSize) { | |
1208 | return FALSE; | |
1209 | } | |
1210 | ||
1211 | for (int32_t i = offset, j = 0; j < otherSize; i += 1, j += 1) { | |
1212 | if (getOrder(i) != other.getOrder(j)) { | |
1213 | return FALSE; | |
1214 | } | |
1215 | } | |
1216 | ||
1217 | return TRUE; | |
1218 | } | |
1219 | ||
1220 | uint64_t PCEList::operator[](int32_t index) const | |
1221 | { | |
1222 | return getOrder(index); | |
1223 | } | |
1224 | ||
1225 | void SSearchTest::boyerMooreTest() | |
1226 | { | |
1227 | UErrorCode status = U_ZERO_ERROR; | |
1228 | UCollator *coll = NULL; | |
1229 | CollData *data = NULL; | |
1230 | const CEList* ce = NULL; | |
1231 | const CEList* ce1 = NULL; | |
1232 | UnicodeString lp = "fuss"; | |
1233 | UnicodeString sp = "fu\\u00DF"; | |
1234 | BoyerMooreSearch *longPattern = NULL; | |
1235 | BoyerMooreSearch *shortPattern = NULL; | |
1236 | UnicodeString targets[] = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball", | |
1237 | "ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF", | |
1238 | "fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"}; | |
1239 | int32_t start = -1, end = -1; | |
1240 | ||
1241 | coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status); | |
1242 | if (U_FAILURE(status)) { | |
1243 | errcheckln(status, "Could not open collator. - %s", u_errorName(status)); | |
1244 | return; | |
1245 | } | |
1246 | ||
1247 | data = CollData::open(coll, status); | |
1248 | if (U_FAILURE(status)) { | |
1249 | errln("Could not open CollData object."); | |
1250 | goto close_data; | |
1251 | } | |
1252 | ||
1253 | data->getDynamicClassID(); | |
1254 | if (U_FAILURE(status)) { | |
1255 | errln("Could not get dynamic class ID of CollData."); | |
1256 | goto close_patterns; | |
1257 | } | |
1258 | ||
1259 | data->getStaticClassID(); | |
1260 | if (U_FAILURE(status)) { | |
1261 | errln("Could not get static class ID of CollData."); | |
1262 | goto close_patterns; | |
1263 | } | |
1264 | ||
1265 | longPattern = new BoyerMooreSearch(data, lp.unescape(), NULL, status); | |
1266 | shortPattern = new BoyerMooreSearch(data, sp.unescape(), NULL, status); | |
1267 | if (U_FAILURE(status)) { | |
1268 | errln("Could not create pattern objects."); | |
1269 | goto close_patterns; | |
1270 | } | |
1271 | ||
1272 | longPattern->getBadCharacterTable(); | |
1273 | shortPattern->getBadCharacterTable(); | |
1274 | if (U_FAILURE(status)) { | |
1275 | errln("Could not get bad character table."); | |
1276 | goto close_patterns; | |
1277 | } | |
1278 | ||
1279 | longPattern->getGoodSuffixTable(); | |
1280 | shortPattern->getGoodSuffixTable(); | |
1281 | if (U_FAILURE(status)) { | |
1282 | errln("Could not get good suffix table."); | |
1283 | goto close_patterns; | |
1284 | } | |
1285 | ||
1286 | longPattern->getDynamicClassID(); | |
1287 | shortPattern->getDynamicClassID(); | |
1288 | if (U_FAILURE(status)) { | |
1289 | errln("Could not get dynamic class ID of BoyerMooreSearch."); | |
1290 | goto close_patterns; | |
1291 | } | |
1292 | ||
1293 | longPattern->getStaticClassID(); | |
1294 | shortPattern->getStaticClassID(); | |
1295 | if (U_FAILURE(status)) { | |
1296 | errln("Could not get static class ID of BoyerMooreSearch."); | |
1297 | goto close_patterns; | |
1298 | } | |
1299 | ||
1300 | longPattern->getData(); | |
1301 | shortPattern->getData(); | |
1302 | if (U_FAILURE(status)) { | |
1303 | errln("Could not get collate data."); | |
1304 | goto close_patterns; | |
1305 | } | |
1306 | ||
1307 | ce = longPattern->getPatternCEs(); | |
1308 | ce1 = shortPattern->getPatternCEs(); | |
1309 | if (U_FAILURE(status)) { | |
1310 | errln("Could not get pattern CEs."); | |
1311 | goto close_patterns; | |
1312 | } | |
1313 | ||
1314 | ce->getDynamicClassID(); | |
1315 | ce1->getDynamicClassID(); | |
1316 | if (U_FAILURE(status)) { | |
1317 | errln("Could not get dynamic class ID of CEList."); | |
1318 | goto close_patterns; | |
1319 | } | |
1320 | ||
1321 | ce->getStaticClassID(); | |
1322 | ce1->getStaticClassID(); | |
1323 | if (U_FAILURE(status)) { | |
1324 | errln("Could not get static class ID of CEList."); | |
1325 | goto close_patterns; | |
1326 | } | |
1327 | ||
1328 | if(data->minLengthInChars(ce,0) != 3){ | |
1329 | errln("Minimal Length in Characters for 'data' with 'ce' was suppose to give 3."); | |
1330 | goto close_patterns; | |
1331 | } | |
1332 | ||
1333 | if(data->minLengthInChars(ce1,0) != 3){ | |
1334 | errln("Minimal Length in Characters for 'data' with 'ce1' was suppose to give 3."); | |
1335 | goto close_patterns; | |
1336 | } | |
1337 | ||
1338 | for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) { | |
1339 | UnicodeString target = targets[t].unescape(); | |
1340 | ||
1341 | longPattern->setTargetString(&target, status); | |
1342 | if (longPattern->search(0, start, end)) { | |
1343 | logln("Test %d: found long pattern at [%d, %d].", t, start, end); | |
1344 | } else { | |
1345 | errln("Test %d: did not find long pattern.", t); | |
1346 | } | |
1347 | ||
1348 | shortPattern->setTargetString(&target, status); | |
1349 | if (shortPattern->search(0, start, end)) { | |
1350 | logln("Test %d: found short pattern at [%d, %d].", t, start, end); | |
1351 | } else { | |
1352 | errln("Test %d: did not find short pattern.", t); | |
1353 | } | |
1354 | ||
1355 | if(longPattern->empty()){ | |
1356 | errln("Test %d: Long pattern should not have been empty."); | |
1357 | } | |
1358 | ||
1359 | if(shortPattern->empty()){ | |
1360 | errln("Test %d: Short pattern should not have been empty."); | |
1361 | } | |
1362 | } | |
1363 | ||
1364 | close_patterns: | |
1365 | delete shortPattern; | |
1366 | delete longPattern; | |
1367 | ||
1368 | close_data: | |
1369 | CollData::close(data); | |
1370 | ucol_close(coll); | |
1371 | } | |
1372 | ||
1373 | void SSearchTest::bmsTest() | |
1374 | { | |
1375 | UErrorCode status = U_ZERO_ERROR; | |
1376 | UCollator *coll = NULL; | |
1377 | UCD *data = NULL; | |
1378 | UnicodeString lp = "fuss"; | |
1379 | UnicodeString lpu = lp.unescape(); | |
1380 | UnicodeString sp = "fu\\u00DF"; | |
1381 | UnicodeString spu = sp.unescape(); | |
1382 | BMS *longPattern = NULL; | |
1383 | BMS *shortPattern = NULL; | |
1384 | UnicodeString targets[] = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball", | |
1385 | "ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF", | |
1386 | "fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"}; | |
1387 | int32_t start = -1, end = -1; | |
1388 | ||
1389 | coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status); | |
1390 | if (U_FAILURE(status)) { | |
1391 | errcheckln(status, "Could not open collator. - %s", u_errorName(status)); | |
1392 | return; | |
1393 | } | |
1394 | ||
1395 | data = ucd_open(coll, &status); | |
1396 | if (U_FAILURE(status)) { | |
1397 | errln("Could not open CollData object."); | |
1398 | goto close_data; | |
1399 | } | |
1400 | ||
1401 | longPattern = bms_open(data, lpu.getBuffer(), lpu.length(), NULL, 0, &status); | |
1402 | shortPattern = bms_open(data, spu.getBuffer(), spu.length(), NULL, 0, &status); | |
1403 | if (U_FAILURE(status)) { | |
1404 | errln("Couldn't open pattern objects."); | |
1405 | goto close_patterns; | |
1406 | } | |
1407 | ||
1408 | for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) { | |
1409 | UnicodeString target = targets[t].unescape(); | |
1410 | ||
1411 | bms_setTargetString(longPattern, target.getBuffer(), target.length(), &status); | |
1412 | if (bms_search(longPattern, 0, &start, &end)) { | |
1413 | logln("Test %d: found long pattern at [%d, %d].", t, start, end); | |
1414 | } else { | |
1415 | errln("Test %d: did not find long pattern.", t); | |
1416 | } | |
1417 | ||
1418 | bms_setTargetString(shortPattern, target.getBuffer(), target.length(), &status); | |
1419 | if (bms_search(shortPattern, 0, &start, &end)) { | |
1420 | logln("Test %d: found short pattern at [%d, %d].", t, start, end); | |
1421 | } else { | |
1422 | errln("Test %d: did not find short pattern.", t); | |
1423 | } | |
1424 | } | |
1425 | ||
1426 | /* Add better coverage for bms code. */ | |
1427 | if(bms_empty(longPattern)) { | |
1428 | errln("FAIL: longgPattern is empty."); | |
1429 | } | |
1430 | ||
1431 | if (!bms_getData(longPattern)) { | |
1432 | errln("FAIL: bms_getData returned NULL."); | |
1433 | } | |
1434 | ||
1435 | if (!ucd_getCollator(data)) { | |
1436 | errln("FAIL: ucd_getCollator returned NULL."); | |
1437 | } | |
1438 | ||
1439 | close_patterns: | |
1440 | bms_close(shortPattern); | |
1441 | bms_close(longPattern); | |
1442 | ||
1443 | close_data: | |
1444 | ucd_close(data); | |
1445 | ucd_freeCache(); | |
1446 | ucol_close(coll); | |
1447 | } | |
1448 | ||
1449 | void SSearchTest::goodSuffixTest() | |
1450 | { | |
1451 | UErrorCode status = U_ZERO_ERROR; | |
1452 | UCollator *coll = NULL; | |
1453 | CollData *data = NULL; | |
1454 | UnicodeString pat = /*"gcagagag"*/ "fxeld"; | |
1455 | UnicodeString target = /*"gcatcgcagagagtatacagtacg"*/ "cloveldfxeld"; | |
1456 | BoyerMooreSearch *pattern = NULL; | |
1457 | int32_t start = -1, end = -1; | |
1458 | ||
1459 | coll = ucol_open(NULL, &status); | |
1460 | if (U_FAILURE(status)) { | |
1461 | errcheckln(status, "Couldn't open collator. - %s", u_errorName(status)); | |
1462 | return; | |
1463 | } | |
1464 | ||
1465 | data = CollData::open(coll, status); | |
1466 | if (U_FAILURE(status)) { | |
1467 | errln("Couldn't open CollData object."); | |
1468 | goto close_data; | |
1469 | } | |
1470 | ||
1471 | pattern = new BoyerMooreSearch(data, pat, &target, status); | |
1472 | if (U_FAILURE(status)) { | |
1473 | errln("Couldn't open pattern object."); | |
1474 | goto close_pattern; | |
1475 | } | |
1476 | ||
1477 | if (pattern->search(0, start, end)) { | |
1478 | logln("Found pattern at [%d, %d].", start, end); | |
1479 | } else { | |
1480 | errln("Did not find pattern."); | |
1481 | } | |
1482 | ||
1483 | close_pattern: | |
1484 | delete pattern; | |
1485 | ||
1486 | close_data: | |
1487 | CollData::close(data); | |
1488 | ucol_close(coll); | |
1489 | } | |
1490 | ||
1491 | // | |
1492 | // searchTime() A quick and dirty performance test for string search. | |
1493 | // Probably doesn't really belong as part of intltest, but it | |
1494 | // does check that the search succeeds, and gets the right result, | |
1495 | // so it serves as a functionality test also. | |
1496 | // | |
1497 | // To run as a perf test, up the loop count, select by commenting | |
1498 | // and uncommenting in the code the operation to be measured, | |
1499 | // rebuild, and measure the running time of this test alone. | |
1500 | // | |
1501 | // time LD_LIBRARY_PATH=whatever ./intltest collate/SSearchTest/searchTime | |
1502 | // | |
1503 | void SSearchTest::searchTime() { | |
1504 | static const char *longishText = | |
1505 | "Whylom, as olde stories tellen us,\n" | |
1506 | "Ther was a duk that highte Theseus:\n" | |
1507 | "Of Athenes he was lord and governour,\n" | |
1508 | "And in his tyme swich a conquerour,\n" | |
1509 | "That gretter was ther noon under the sonne.\n" | |
1510 | "Ful many a riche contree hadde he wonne;\n" | |
1511 | "What with his wisdom and his chivalrye,\n" | |
1512 | "He conquered al the regne of Femenye,\n" | |
1513 | "That whylom was y-cleped Scithia;\n" | |
1514 | "And weddede the quene Ipolita,\n" | |
1515 | "And broghte hir hoom with him in his contree\n" | |
1516 | "With muchel glorie and greet solempnitee,\n" | |
1517 | "And eek hir yonge suster Emelye.\n" | |
1518 | "And thus with victorie and with melodye\n" | |
1519 | "Lete I this noble duk to Athenes ryde,\n" | |
1520 | "And al his hoost, in armes, him bisyde.\n" | |
1521 | "And certes, if it nere to long to here,\n" | |
1522 | "I wolde han told yow fully the manere,\n" | |
1523 | "How wonnen was the regne of Femenye\n" | |
1524 | "By Theseus, and by his chivalrye;\n" | |
1525 | "And of the grete bataille for the nones\n" | |
1526 | "Bitwixen Athen's and Amazones;\n" | |
1527 | "And how asseged was Ipolita,\n" | |
1528 | "The faire hardy quene of Scithia;\n" | |
1529 | "And of the feste that was at hir weddinge,\n" | |
1530 | "And of the tempest at hir hoom-cominge;\n" | |
1531 | "But al that thing I moot as now forbere.\n" | |
1532 | "I have, God woot, a large feeld to ere,\n" | |
1533 | "And wayke been the oxen in my plough.\n" | |
1534 | "The remenant of the tale is long y-nough.\n" | |
1535 | "I wol nat letten eek noon of this route;\n" | |
1536 | "Lat every felawe telle his tale aboute,\n" | |
1537 | "And lat see now who shal the soper winne;\n" | |
1538 | "And ther I lefte, I wol ageyn biginne.\n" | |
1539 | "This duk, of whom I make mencioun,\n" | |
1540 | "When he was come almost unto the toun,\n" | |
1541 | "In al his wele and in his moste pryde,\n" | |
1542 | "He was war, as he caste his eye asyde,\n" | |
1543 | "Wher that ther kneled in the hye weye\n" | |
1544 | "A companye of ladies, tweye and tweye,\n" | |
1545 | "Ech after other, clad in clothes blake; \n" | |
1546 | "But swich a cry and swich a wo they make,\n" | |
1547 | "That in this world nis creature livinge,\n" | |
1548 | "That herde swich another weymentinge;\n" | |
1549 | "And of this cry they nolde never stenten,\n" | |
1550 | "Til they the reynes of his brydel henten.\n" | |
1551 | "'What folk ben ye, that at myn hoomcominge\n" | |
1552 | "Perturben so my feste with cryinge'?\n" | |
1553 | "Quod Theseus, 'have ye so greet envye\n" | |
1554 | "Of myn honour, that thus compleyne and crye? \n" | |
1555 | "Or who hath yow misboden, or offended?\n" | |
1556 | "And telleth me if it may been amended;\n" | |
1557 | "And why that ye ben clothed thus in blak'?\n" | |
1558 | "The eldest lady of hem alle spak,\n" | |
1559 | "When she hadde swowned with a deedly chere,\n" | |
1560 | "That it was routhe for to seen and here,\n" | |
1561 | "And seyde: 'Lord, to whom Fortune hath yiven\n" | |
1562 | "Victorie, and as a conquerour to liven,\n" | |
1563 | "Noght greveth us your glorie and your honour;\n" | |
1564 | "But we biseken mercy and socour.\n" | |
1565 | "Have mercy on our wo and our distresse.\n" | |
1566 | "Som drope of pitee, thurgh thy gentilesse,\n" | |
1567 | "Up-on us wrecched wommen lat thou falle.\n" | |
1568 | "For certes, lord, ther nis noon of us alle,\n" | |
1569 | "That she nath been a duchesse or a quene;\n" | |
1570 | "Now be we caitifs, as it is wel sene:\n" | |
1571 | "Thanked be Fortune, and hir false wheel,\n" | |
1572 | "That noon estat assureth to be weel.\n" | |
1573 | "And certes, lord, t'abyden your presence,\n" | |
1574 | "Here in the temple of the goddesse Clemence\n" | |
1575 | "We han ben waytinge al this fourtenight;\n" | |
1576 | "Now help us, lord, sith it is in thy might.\n" | |
1577 | "I wrecche, which that wepe and waille thus,\n" | |
1578 | "Was whylom wyf to king Capaneus,\n" | |
1579 | "That starf at Thebes, cursed be that day!\n" | |
1580 | "And alle we, that been in this array,\n" | |
1581 | "And maken al this lamentacioun,\n" | |
1582 | "We losten alle our housbondes at that toun,\n" | |
1583 | "Whyl that the sege ther-aboute lay.\n" | |
1584 | "And yet now th'olde Creon, weylaway!\n" | |
1585 | "The lord is now of Thebes the citee, \n" | |
1586 | "Fulfild of ire and of iniquitee,\n" | |
1587 | "He, for despyt, and for his tirannye,\n" | |
1588 | "To do the dede bodyes vileinye,\n" | |
1589 | "Of alle our lordes, whiche that ben slawe,\n" | |
1590 | "Hath alle the bodyes on an heep y-drawe,\n" | |
1591 | "And wol nat suffren hem, by noon assent,\n" | |
1592 | "Neither to been y-buried nor y-brent,\n" | |
1593 | "But maketh houndes ete hem in despyt. zet'\n"; | |
1594 | ||
1595 | #define TEST_BOYER_MOORE 1 | |
1596 | const char *cPattern = "maketh houndes ete hem"; | |
1597 | //const char *cPattern = "Whylom"; | |
1598 | //const char *cPattern = "zet"; | |
1599 | const char *testId = "searchTime()"; // for error macros. | |
1600 | UnicodeString target = longishText; | |
1601 | UErrorCode status = U_ZERO_ERROR; | |
1602 | ||
1603 | ||
1604 | LocalUCollatorPointer collator(ucol_open("en", &status)); | |
1605 | CollData *data = CollData::open(collator.getAlias(), status); | |
1606 | if (U_FAILURE(status) || collator.isNull() || data == NULL) { | |
1607 | errcheckln(status, "Unable to open UCollator or CollData. - %s", u_errorName(status)); | |
1608 | return; | |
1609 | } | |
1610 | //ucol_setStrength(collator.getAlias(), collatorStrength); | |
1611 | //ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status); | |
1612 | UnicodeString uPattern = cPattern; | |
1613 | #ifndef TEST_BOYER_MOORE | |
1614 | LocalUStringSearchPointer uss(usearch_openFromCollator(uPattern.getBuffer(), uPattern.length(), | |
1615 | target.getBuffer(), target.length(), | |
1616 | collator.getAlias(), | |
1617 | NULL, // the break iterator | |
1618 | &status)); | |
1619 | TEST_ASSERT_SUCCESS(status); | |
1620 | #else | |
1621 | BoyerMooreSearch bms(data, uPattern, &target, status); | |
1622 | TEST_ASSERT_SUCCESS(status); | |
1623 | #endif | |
1624 | ||
1625 | // int32_t foundStart; | |
1626 | // int32_t foundEnd; | |
1627 | UBool found; | |
1628 | ||
1629 | // Find the match position usgin strstr | |
1630 | const char *pm = strstr(longishText, cPattern); | |
1631 | TEST_ASSERT_M(pm!=NULL, "No pattern match with strstr"); | |
1632 | int32_t refMatchPos = (int32_t)(pm - longishText); | |
1633 | int32_t icuMatchPos; | |
1634 | int32_t icuMatchEnd; | |
1635 | #ifndef TEST_BOYER_MOORE | |
1636 | usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status); | |
1637 | TEST_ASSERT_SUCCESS(status); | |
1638 | #else | |
1639 | found = bms.search(0, icuMatchPos, icuMatchEnd); | |
1640 | #endif | |
1641 | TEST_ASSERT_M(refMatchPos == icuMatchPos, "strstr and icu give different match positions."); | |
1642 | ||
1643 | int32_t i; | |
1644 | int32_t j=0; | |
1645 | ||
1646 | // Try loopcounts around 100000 to some millions, depending on the operation, | |
1647 | // to get runtimes of at least several seconds. | |
1648 | for (i=0; i<10000; i++) { | |
1649 | #ifndef TEST_BOYER_MOORE | |
1650 | found = usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status); | |
1651 | #else | |
1652 | found = bms.search(0, icuMatchPos, icuMatchEnd); | |
1653 | #endif | |
1654 | //TEST_ASSERT_SUCCESS(status); | |
1655 | //TEST_ASSERT(found); | |
1656 | ||
1657 | // usearch_setOffset(uss.getAlias(), 0, &status); | |
1658 | // icuMatchPos = usearch_next(uss.getAlias(), &status); | |
1659 | ||
1660 | // The i+j stuff is to confuse the optimizer and get it to actually leave the | |
1661 | // call to strstr in place. | |
1662 | //pm = strstr(longishText+j, cPattern); | |
1663 | //j = (j + i)%5; | |
1664 | } | |
1665 | ||
1666 | printf("%ld, %d\n", pm-longishText, j); | |
1667 | #ifdef TEST_BOYER_MOORE | |
1668 | CollData::close(data); | |
1669 | #endif | |
1670 | } | |
1671 | #endif | |
1672 | ||
1673 | //---------------------------------------------------------------------------------------- | |
1674 | // | |
1675 | // Random Numbers. Similar to standard lib rand() and srand() | |
1676 | // Not using library to | |
1677 | // 1. Get same results on all platforms. | |
1678 | // 2. Get access to current seed, to more easily reproduce failures. | |
1679 | // | |
1680 | //--------------------------------------------------------------------------------------- | |
1681 | static uint32_t m_seed = 1; | |
1682 | ||
1683 | static uint32_t m_rand() | |
1684 | { | |
1685 | m_seed = m_seed * 1103515245 + 12345; | |
1686 | return (uint32_t)(m_seed/65536) % 32768; | |
1687 | } | |
1688 | ||
1689 | class Monkey | |
1690 | { | |
1691 | public: | |
1692 | virtual void append(UnicodeString &test, UnicodeString &alternate) = 0; | |
1693 | ||
1694 | protected: | |
1695 | Monkey(); | |
1696 | virtual ~Monkey(); | |
1697 | }; | |
1698 | ||
1699 | Monkey::Monkey() | |
1700 | { | |
1701 | // ook? | |
1702 | } | |
1703 | ||
1704 | Monkey::~Monkey() | |
1705 | { | |
1706 | // ook? | |
1707 | } | |
1708 | ||
1709 | class SetMonkey : public Monkey | |
1710 | { | |
1711 | public: | |
1712 | SetMonkey(const USet *theSet); | |
1713 | ~SetMonkey(); | |
1714 | ||
1715 | virtual void append(UnicodeString &test, UnicodeString &alternate); | |
1716 | ||
1717 | private: | |
1718 | const USet *set; | |
1719 | }; | |
1720 | ||
1721 | SetMonkey::SetMonkey(const USet *theSet) | |
1722 | : Monkey(), set(theSet) | |
1723 | { | |
1724 | // ook? | |
1725 | } | |
1726 | ||
1727 | SetMonkey::~SetMonkey() | |
1728 | { | |
1729 | //ook... | |
1730 | } | |
1731 | ||
1732 | void SetMonkey::append(UnicodeString &test, UnicodeString &alternate) | |
1733 | { | |
1734 | int32_t size = uset_size(set); | |
1735 | int32_t index = m_rand() % size; | |
1736 | UChar32 ch = uset_charAt(set, index); | |
1737 | UnicodeString str(ch); | |
1738 | ||
1739 | test.append(str); | |
1740 | alternate.append(str); // flip case, or some junk? | |
1741 | } | |
1742 | ||
1743 | class StringSetMonkey : public Monkey | |
1744 | { | |
1745 | public: | |
1746 | StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData); | |
1747 | ~StringSetMonkey(); | |
1748 | ||
1749 | void append(UnicodeString &testCase, UnicodeString &alternate); | |
1750 | ||
1751 | private: | |
1752 | UnicodeString &generateAlternative(const UnicodeString &testCase, UnicodeString &alternate); | |
1753 | ||
1754 | const USet *set; | |
1755 | UCollator *coll; | |
1756 | CollData *collData; | |
1757 | }; | |
1758 | ||
1759 | StringSetMonkey::StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData) | |
1760 | : Monkey(), set(theSet), coll(theCollator), collData(theCollData) | |
1761 | { | |
1762 | // ook. | |
1763 | } | |
1764 | ||
1765 | StringSetMonkey::~StringSetMonkey() | |
1766 | { | |
1767 | // ook? | |
1768 | } | |
1769 | ||
1770 | void StringSetMonkey::append(UnicodeString &testCase, UnicodeString &alternate) | |
1771 | { | |
1772 | int32_t itemCount = uset_getItemCount(set), len = 0; | |
1773 | int32_t index = m_rand() % itemCount; | |
1774 | UChar32 rangeStart = 0, rangeEnd = 0; | |
1775 | UChar buffer[16]; | |
1776 | UErrorCode err = U_ZERO_ERROR; | |
1777 | ||
1778 | len = uset_getItem(set, index, &rangeStart, &rangeEnd, buffer, 16, &err); | |
1779 | ||
1780 | if (len == 0) { | |
1781 | int32_t offset = m_rand() % (rangeEnd - rangeStart + 1); | |
1782 | UChar32 ch = rangeStart + offset; | |
1783 | UnicodeString str(ch); | |
1784 | ||
1785 | testCase.append(str); | |
1786 | generateAlternative(str, alternate); | |
1787 | } else if (len > 0) { | |
1788 | // should check that len < 16... | |
1789 | UnicodeString str(buffer, len); | |
1790 | ||
1791 | testCase.append(str); | |
1792 | generateAlternative(str, alternate); | |
1793 | } else { | |
1794 | // shouldn't happen... | |
1795 | } | |
1796 | } | |
1797 | ||
1798 | UnicodeString &StringSetMonkey::generateAlternative(const UnicodeString &testCase, UnicodeString &alternate) | |
1799 | { | |
1800 | // find out shortest string for the longest sequence of ces. | |
1801 | // needs to be refined to use dynamic programming, but will be roughly right | |
1802 | UErrorCode status = U_ZERO_ERROR; | |
1803 | CEList ceList(coll, testCase, status); | |
1804 | UnicodeString alt; | |
1805 | int32_t offset = 0; | |
1806 | ||
1807 | if (ceList.size() == 0) { | |
1808 | return alternate.append(testCase); | |
1809 | } | |
1810 | ||
1811 | while (offset < ceList.size()) { | |
1812 | int32_t ce = ceList.get(offset); | |
1813 | const StringList *strings = collData->getStringList(ce); | |
1814 | ||
1815 | if (strings == NULL) { | |
1816 | return alternate.append(testCase); | |
1817 | } | |
1818 | ||
1819 | int32_t stringCount = strings->size(); | |
1820 | int32_t tries = 0; | |
1821 | ||
1822 | // find random string that generates the same CEList | |
1823 | const CEList *ceList2 = NULL; | |
1824 | const UnicodeString *string = NULL; | |
1825 | UBool matches = FALSE; | |
1826 | ||
1827 | do { | |
1828 | int32_t s = m_rand() % stringCount; | |
1829 | ||
1830 | if (tries++ > stringCount) { | |
1831 | alternate.append(testCase); | |
1832 | return alternate; | |
1833 | } | |
1834 | ||
1835 | string = strings->get(s); | |
1836 | ceList2 = collData->getCEList(string); | |
1837 | matches = ceList.matchesAt(offset, ceList2); | |
1838 | ||
1839 | if (! matches) { | |
1840 | collData->freeCEList((CEList *) ceList2); | |
1841 | } | |
1842 | } while (! matches); | |
1843 | ||
1844 | alt.append(*string); | |
1845 | offset += ceList2->size(); | |
1846 | collData->freeCEList(ceList2); | |
1847 | } | |
1848 | ||
1849 | const CEList altCEs(coll, alt, status); | |
1850 | ||
1851 | if (ceList.matchesAt(0, &altCEs)) { | |
1852 | return alternate.append(alt); | |
1853 | } | |
1854 | ||
1855 | return alternate.append(testCase); | |
1856 | } | |
1857 | ||
1858 | static void generateTestCase(UCollator *coll, Monkey *monkeys[], int32_t monkeyCount, UnicodeString &testCase, UnicodeString &alternate) | |
1859 | { | |
1860 | int32_t pieces = (m_rand() % 4) + 1; | |
1861 | UErrorCode status = U_ZERO_ERROR; | |
1862 | UBool matches; | |
1863 | ||
1864 | do { | |
1865 | testCase.remove(); | |
1866 | alternate.remove(); | |
1867 | monkeys[0]->append(testCase, alternate); | |
1868 | ||
1869 | for(int32_t piece = 0; piece < pieces; piece += 1) { | |
1870 | int32_t monkey = m_rand() % monkeyCount; | |
1871 | ||
1872 | monkeys[monkey]->append(testCase, alternate); | |
1873 | } | |
1874 | ||
1875 | const CEList ceTest(coll, testCase, status); | |
1876 | const CEList ceAlt(coll, alternate, status); | |
1877 | ||
1878 | matches = ceTest.matchesAt(0, &ceAlt); | |
1879 | } while (! matches); | |
1880 | } | |
1881 | ||
1882 | // | |
1883 | // Find the next acceptable boundary following the specified starting index | |
1884 | // in the target text being searched. | |
1885 | // TODO: refine what is an acceptable boundary. For the moment, | |
1886 | // choose the next position not within a combining sequence. | |
1887 | // | |
1888 | #if 0 | |
1889 | static int32_t nextBoundaryAfter(const UnicodeString &string, int32_t startIndex) { | |
1890 | const UChar *text = string.getBuffer(); | |
1891 | int32_t textLen = string.length(); | |
1892 | ||
1893 | if (startIndex >= textLen) { | |
1894 | return startIndex; | |
1895 | } | |
1896 | ||
1897 | UChar32 c; | |
1898 | int32_t i = startIndex; | |
1899 | ||
1900 | U16_NEXT(text, i, textLen, c); | |
1901 | ||
1902 | // If we are on a control character, stop without looking for combining marks. | |
1903 | // Control characters do not combine. | |
1904 | int32_t gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK); | |
1905 | if (gcProperty==U_GCB_CONTROL || gcProperty==U_GCB_LF || gcProperty==U_GCB_CR) { | |
1906 | return i; | |
1907 | } | |
1908 | ||
1909 | // The initial character was not a control, and can thus accept trailing | |
1910 | // combining characters. Advance over however many of them there are. | |
1911 | int32_t indexOfLastCharChecked; | |
1912 | ||
1913 | for (;;) { | |
1914 | indexOfLastCharChecked = i; | |
1915 | ||
1916 | if (i>=textLen) { | |
1917 | break; | |
1918 | } | |
1919 | ||
1920 | U16_NEXT(text, i, textLen, c); | |
1921 | gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK); | |
1922 | ||
1923 | if (gcProperty != U_GCB_EXTEND && gcProperty != U_GCB_SPACING_MARK) { | |
1924 | break; | |
1925 | } | |
1926 | } | |
1927 | ||
1928 | return indexOfLastCharChecked; | |
1929 | } | |
1930 | #endif | |
1931 | ||
1932 | #if 0 | |
1933 | static UBool isInCombiningSequence(const UnicodeString &string, int32_t index) { | |
1934 | const UChar *text = string.getBuffer(); | |
1935 | int32_t textLen = string.length(); | |
1936 | ||
1937 | if (index>=textLen || index<=0) { | |
1938 | return FALSE; | |
1939 | } | |
1940 | ||
1941 | // If the character at the current index is not a GRAPHEME_EXTEND | |
1942 | // then we can not be within a combining sequence. | |
1943 | UChar32 c; | |
1944 | U16_GET(text, 0, index, textLen, c); | |
1945 | int32_t gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK); | |
1946 | if (gcProperty != U_GCB_EXTEND && gcProperty != U_GCB_SPACING_MARK) { | |
1947 | return FALSE; | |
1948 | } | |
1949 | ||
1950 | // We are at a combining mark. If the preceding character is anything | |
1951 | // except a CONTROL, CR or LF, we are in a combining sequence. | |
1952 | U16_PREV(text, 0, index, c); | |
1953 | gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK); | |
1954 | ||
1955 | return !(gcProperty==U_GCB_CONTROL || gcProperty==U_GCB_LF || gcProperty==U_GCB_CR); | |
1956 | } | |
1957 | #endif | |
1958 | ||
1959 | static UBool simpleSearch(UCollator *coll, const UnicodeString &target, int32_t offset, const UnicodeString &pattern, int32_t &matchStart, int32_t &matchEnd) | |
1960 | { | |
1961 | UErrorCode status = U_ZERO_ERROR; | |
1962 | OrderList targetOrders(coll, target, offset); | |
1963 | OrderList patternOrders(coll, pattern); | |
1964 | int32_t targetSize = targetOrders.size() - 1; | |
1965 | int32_t patternSize = patternOrders.size() - 1; | |
1966 | UBreakIterator *charBreakIterator = ubrk_open(UBRK_CHARACTER, ucol_getLocaleByType(coll, ULOC_VALID_LOCALE, &status), | |
1967 | target.getBuffer(), target.length(), &status); | |
1968 | ||
1969 | if (patternSize == 0) { | |
1970 | // Searching for an empty pattern always fails | |
1971 | matchStart = matchEnd = -1; | |
1972 | ubrk_close(charBreakIterator); | |
1973 | return FALSE; | |
1974 | } | |
1975 | ||
1976 | matchStart = matchEnd = -1; | |
1977 | ||
1978 | for(int32_t i = 0; i < targetSize; i += 1) { | |
1979 | if (targetOrders.matchesAt(i, patternOrders)) { | |
1980 | int32_t start = targetOrders.getLowOffset(i); | |
1981 | int32_t maxLimit = targetOrders.getLowOffset(i + patternSize); | |
1982 | int32_t minLimit = targetOrders.getLowOffset(i + patternSize - 1); | |
1983 | ||
1984 | // if the low and high offsets of the first CE in | |
1985 | // the match are the same, it means that the match | |
1986 | // starts in the middle of an expansion - all but | |
1987 | // the first CE of the expansion will have the offset | |
1988 | // of the following character. | |
1989 | if (start == targetOrders.getHighOffset(i)) { | |
1990 | continue; | |
1991 | } | |
1992 | ||
1993 | // Make sure match starts on a grapheme boundary | |
1994 | if (! ubrk_isBoundary(charBreakIterator, start)) { | |
1995 | continue; | |
1996 | } | |
1997 | ||
1998 | // If the low and high offsets of the CE after the match | |
1999 | // are the same, it means that the match ends in the middle | |
2000 | // of an expansion sequence. | |
2001 | if (maxLimit == targetOrders.getHighOffset(i + patternSize) && | |
2002 | targetOrders.getOrder(i + patternSize) != UCOL_NULLORDER) { | |
2003 | continue; | |
2004 | } | |
2005 | ||
2006 | int32_t mend = maxLimit; | |
2007 | ||
2008 | // Find the first grapheme break after the character index | |
2009 | // of the last CE in the match. If it's after character index | |
2010 | // that's after the last CE in the match, use that index | |
2011 | // as the end of the match. | |
2012 | if (minLimit < maxLimit) { | |
2013 | int32_t nba = ubrk_following(charBreakIterator, minLimit); | |
2014 | ||
2015 | if (nba >= targetOrders.getHighOffset(i + patternSize - 1)) { | |
2016 | mend = nba; | |
2017 | } | |
2018 | } | |
2019 | ||
2020 | if (mend > maxLimit) { | |
2021 | continue; | |
2022 | } | |
2023 | ||
2024 | if (! ubrk_isBoundary(charBreakIterator, mend)) { | |
2025 | continue; | |
2026 | } | |
2027 | ||
2028 | matchStart = start; | |
2029 | matchEnd = mend; | |
2030 | ||
2031 | ubrk_close(charBreakIterator); | |
2032 | return TRUE; | |
2033 | } | |
2034 | } | |
2035 | ||
2036 | ubrk_close(charBreakIterator); | |
2037 | return FALSE; | |
2038 | } | |
2039 | ||
2040 | #if !UCONFIG_NO_REGULAR_EXPRESSIONS | |
2041 | static int32_t getIntParam(UnicodeString name, UnicodeString ¶ms, int32_t defaultVal) { | |
2042 | int32_t val = defaultVal; | |
2043 | ||
2044 | name.append(" *= *(-?\\d+)"); | |
2045 | ||
2046 | UErrorCode status = U_ZERO_ERROR; | |
2047 | RegexMatcher m(name, params, 0, status); | |
2048 | ||
2049 | if (m.find()) { | |
2050 | // The param exists. Convert the string to an int. | |
2051 | char valString[100]; | |
2052 | int32_t paramLength = m.end(1, status) - m.start(1, status); | |
2053 | ||
2054 | if (paramLength >= (int32_t)(sizeof(valString)-1)) { | |
2055 | paramLength = (int32_t)(sizeof(valString)-2); | |
2056 | } | |
2057 | ||
2058 | params.extract(m.start(1, status), paramLength, valString, sizeof(valString)); | |
2059 | val = strtol(valString, NULL, 10); | |
2060 | ||
2061 | // Delete this parameter from the params string. | |
2062 | m.reset(); | |
2063 | params = m.replaceFirst("", status); | |
2064 | } | |
2065 | ||
2066 | //U_ASSERT(U_SUCCESS(status)); | |
2067 | if (! U_SUCCESS(status)) { | |
2068 | val = defaultVal; | |
2069 | } | |
2070 | ||
2071 | return val; | |
2072 | } | |
2073 | #endif | |
2074 | ||
2075 | #if !UCONFIG_NO_COLLATION | |
2076 | int32_t SSearchTest::monkeyTestCase(UCollator *coll, const UnicodeString &testCase, const UnicodeString &pattern, const UnicodeString &altPattern, | |
2077 | const char *name, const char *strength, uint32_t seed) | |
2078 | { | |
2079 | UErrorCode status = U_ZERO_ERROR; | |
2080 | int32_t actualStart = -1, actualEnd = -1; | |
2081 | //int32_t expectedStart = prefix.length(), expectedEnd = prefix.length() + altPattern.length(); | |
2082 | int32_t expectedStart = -1, expectedEnd = -1; | |
2083 | int32_t notFoundCount = 0; | |
2084 | LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(), | |
2085 | testCase.getBuffer(), testCase.length(), | |
2086 | coll, | |
2087 | NULL, // the break iterator | |
2088 | &status)); | |
2089 | ||
2090 | // **** TODO: find *all* matches, not just first one **** | |
2091 | simpleSearch(coll, testCase, 0, pattern, expectedStart, expectedEnd); | |
2092 | ||
2093 | usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status); | |
2094 | ||
2095 | if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) { | |
2096 | errln("Search for <pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n" | |
2097 | " strength=%s seed=%d", | |
2098 | name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed); | |
2099 | } | |
2100 | ||
2101 | if (expectedStart == -1 && actualStart == -1) { | |
2102 | notFoundCount += 1; | |
2103 | } | |
2104 | ||
2105 | // **** TODO: find *all* matches, not just first one **** | |
2106 | simpleSearch(coll, testCase, 0, altPattern, expectedStart, expectedEnd); | |
2107 | ||
2108 | usearch_setPattern(uss.getAlias(), altPattern.getBuffer(), altPattern.length(), &status); | |
2109 | ||
2110 | usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status); | |
2111 | ||
2112 | if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) { | |
2113 | errln("Search for <alt_pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n" | |
2114 | " strength=%s seed=%d", | |
2115 | name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed); | |
2116 | } | |
2117 | ||
2118 | if (expectedStart == -1 && actualStart == -1) { | |
2119 | notFoundCount += 1; | |
2120 | } | |
2121 | ||
2122 | return notFoundCount; | |
2123 | } | |
2124 | ||
2125 | static void hexForUnicodeString(const UnicodeString &ustr, char * cbuf, int32_t cbuflen) | |
2126 | { | |
2127 | int32_t ustri, ustrlen = ustr.length(); | |
2128 | ||
2129 | for (ustri = 0; ustri < ustrlen; ++ustri) { | |
2130 | if (cbuflen >= 9 /* format width for single code unit(5) + terminating ellipsis(3) + null(1) */) { | |
2131 | int len = sprintf(cbuf, " %04X", ustr.charAt(ustri)); | |
2132 | cbuflen -= len; | |
2133 | cbuf += len; | |
2134 | } else { | |
2135 | if (cbuflen >= 4 /* terminating ellipsis(3) + null(1) */) { | |
2136 | sprintf(cbuf, "..."); | |
2137 | } else if (cbuflen >= 1) { | |
2138 | cbuf = 0; | |
2139 | } | |
2140 | break; | |
2141 | } | |
2142 | } | |
2143 | } | |
2144 | ||
2145 | int32_t SSearchTest::bmMonkeyTestCase(UCollator *coll, const UnicodeString &testCase, const UnicodeString &pattern, const UnicodeString &altPattern, | |
2146 | BoyerMooreSearch *bms, BoyerMooreSearch *abms, | |
2147 | const char *name, const char *strength, uint32_t seed) | |
2148 | { | |
2149 | UErrorCode status = U_ZERO_ERROR; | |
2150 | int32_t actualStart = -1, actualEnd = -1; | |
2151 | //int32_t expectedStart = prefix.length(), expectedEnd = prefix.length() + altPattern.length(); | |
2152 | int32_t expectedStart = -1, expectedEnd = -1; | |
2153 | int32_t notFoundCount = 0; | |
2154 | char hexbuf[128]; | |
2155 | ||
2156 | // **** TODO: find *all* matches, not just first one **** | |
2157 | simpleSearch(coll, testCase, 0, pattern, expectedStart, expectedEnd); | |
2158 | ||
2159 | bms->setTargetString(&testCase, status); | |
2160 | bms->search(0, actualStart, actualEnd); | |
2161 | ||
2162 | if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) { | |
2163 | hexForUnicodeString(pattern, hexbuf, sizeof(hexbuf)); | |
2164 | errln("Boyer-Moore Search for <pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n" | |
2165 | " strength=%s seed=%d <pattern>: %s", | |
2166 | name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed, hexbuf); | |
2167 | } | |
2168 | ||
2169 | if (expectedStart == -1 && actualStart == -1) { | |
2170 | notFoundCount += 1; | |
2171 | } | |
2172 | ||
2173 | // **** TODO: find *all* matches, not just first one **** | |
2174 | simpleSearch(coll, testCase, 0, altPattern, expectedStart, expectedEnd); | |
2175 | ||
2176 | abms->setTargetString(&testCase, status); | |
2177 | abms->search(0, actualStart, actualEnd); | |
2178 | ||
2179 | if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) { | |
2180 | hexForUnicodeString(altPattern, hexbuf, sizeof(hexbuf)); | |
2181 | errln("Boyer-Moore Search for <alt_pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n" | |
2182 | " strength=%s seed=%d <pattern>: %s", | |
2183 | name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed, hexbuf); | |
2184 | } | |
2185 | ||
2186 | if (expectedStart == -1 && actualStart == -1) { | |
2187 | notFoundCount += 1; | |
2188 | } | |
2189 | ||
2190 | ||
2191 | return notFoundCount; | |
2192 | } | |
2193 | #endif | |
2194 | ||
2195 | void SSearchTest::monkeyTest(char *params) | |
2196 | { | |
2197 | // ook! | |
2198 | UErrorCode status = U_ZERO_ERROR; | |
2199 | //UCollator *coll = ucol_open(NULL, &status); | |
2200 | UCollator *coll = ucol_openFromShortString("S1", FALSE, NULL, &status); | |
2201 | ||
2202 | if (U_FAILURE(status)) { | |
2203 | errcheckln(status, "Failed to create collator in MonkeyTest! - %s", u_errorName(status)); | |
2204 | return; | |
2205 | } | |
2206 | ||
2207 | CollData *monkeyData = CollData::open(coll, status); | |
2208 | ||
2209 | USet *expansions = uset_openEmpty(); | |
2210 | USet *contractions = uset_openEmpty(); | |
2211 | ||
2212 | ucol_getContractionsAndExpansions(coll, contractions, expansions, FALSE, &status); | |
2213 | ||
2214 | U_STRING_DECL(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39); | |
2215 | U_STRING_INIT(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39); | |
2216 | USet *letters = uset_openPattern(letter_pattern, 39, &status); | |
2217 | SetMonkey letterMonkey(letters); | |
2218 | StringSetMonkey contractionMonkey(contractions, coll, monkeyData); | |
2219 | StringSetMonkey expansionMonkey(expansions, coll, monkeyData); | |
2220 | UnicodeString testCase; | |
2221 | UnicodeString alternate; | |
2222 | UnicodeString pattern, altPattern; | |
2223 | UnicodeString prefix, altPrefix; | |
2224 | UnicodeString suffix, altSuffix; | |
2225 | ||
2226 | Monkey *monkeys[] = { | |
2227 | &letterMonkey, | |
2228 | &contractionMonkey, | |
2229 | &expansionMonkey, | |
2230 | &contractionMonkey, | |
2231 | &expansionMonkey, | |
2232 | &contractionMonkey, | |
2233 | &expansionMonkey, | |
2234 | &contractionMonkey, | |
2235 | &expansionMonkey}; | |
2236 | int32_t monkeyCount = sizeof(monkeys) / sizeof(monkeys[0]); | |
2237 | // int32_t nonMatchCount = 0; | |
2238 | ||
2239 | UCollationStrength strengths[] = {UCOL_PRIMARY, UCOL_SECONDARY, UCOL_TERTIARY}; | |
2240 | const char *strengthNames[] = {"primary", "secondary", "tertiary"}; | |
2241 | int32_t strengthCount = sizeof(strengths) / sizeof(strengths[0]); | |
2242 | int32_t loopCount = quick? 1000 : 10000; | |
2243 | int32_t firstStrength = 0; | |
2244 | int32_t lastStrength = strengthCount - 1; //*/ 0; | |
2245 | ||
2246 | if (params != NULL) { | |
2247 | #if !UCONFIG_NO_REGULAR_EXPRESSIONS | |
2248 | UnicodeString p(params); | |
2249 | ||
2250 | loopCount = getIntParam("loop", p, loopCount); | |
2251 | m_seed = getIntParam("seed", p, m_seed); | |
2252 | ||
2253 | RegexMatcher m(" *strength *= *(primary|secondary|tertiary) *", p, 0, status); | |
2254 | if (m.find()) { | |
2255 | UnicodeString breakType = m.group(1, status); | |
2256 | ||
2257 | for (int32_t s = 0; s < strengthCount; s += 1) { | |
2258 | if (breakType == strengthNames[s]) { | |
2259 | firstStrength = lastStrength = s; | |
2260 | break; | |
2261 | } | |
2262 | } | |
2263 | ||
2264 | m.reset(); | |
2265 | p = m.replaceFirst("", status); | |
2266 | } | |
2267 | ||
2268 | if (RegexMatcher("\\S", p, 0, status).find()) { | |
2269 | // Each option is stripped out of the option string as it is processed. | |
2270 | // All options have been checked. The option string should have been completely emptied.. | |
2271 | char buf[100]; | |
2272 | p.extract(buf, sizeof(buf), NULL, status); | |
2273 | buf[sizeof(buf)-1] = 0; | |
2274 | errln("Unrecognized or extra parameter: %s\n", buf); | |
2275 | return; | |
2276 | } | |
2277 | #else | |
2278 | infoln("SSearchTest built with UCONFIG_NO_REGULAR_EXPRESSIONS: ignoring parameters."); | |
2279 | #endif | |
2280 | } | |
2281 | ||
2282 | for(int32_t s = firstStrength; s <= lastStrength; s += 1) { | |
2283 | int32_t notFoundCount = 0; | |
2284 | ||
2285 | logln("Setting strength to %s.", strengthNames[s]); | |
2286 | ucol_setStrength(coll, strengths[s]); | |
2287 | ||
2288 | // TODO: try alternate prefix and suffix too? | |
2289 | // TODO: alterntaes are only equal at primary strength. Is this OK? | |
2290 | for(int32_t t = 0; t < loopCount; t += 1) { | |
2291 | uint32_t seed = m_seed; | |
2292 | // int32_t nmc = 0; | |
2293 | ||
2294 | generateTestCase(coll, monkeys, monkeyCount, pattern, altPattern); | |
2295 | generateTestCase(coll, monkeys, monkeyCount, prefix, altPrefix); | |
2296 | generateTestCase(coll, monkeys, monkeyCount, suffix, altSuffix); | |
2297 | ||
2298 | // pattern | |
2299 | notFoundCount += monkeyTestCase(coll, pattern, pattern, altPattern, "pattern", strengthNames[s], seed); | |
2300 | ||
2301 | testCase.remove(); | |
2302 | testCase.append(prefix); | |
2303 | testCase.append(/*alt*/pattern); | |
2304 | ||
2305 | // prefix + pattern | |
2306 | notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern", strengthNames[s], seed); | |
2307 | ||
2308 | testCase.append(suffix); | |
2309 | ||
2310 | // prefix + pattern + suffix | |
2311 | notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern + suffix", strengthNames[s], seed); | |
2312 | ||
2313 | testCase.remove(); | |
2314 | testCase.append(pattern); | |
2315 | testCase.append(suffix); | |
2316 | ||
2317 | // pattern + suffix | |
2318 | notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "pattern + suffix", strengthNames[s], seed); | |
2319 | } | |
2320 | ||
2321 | logln("For strength %s the not found count is %d.", strengthNames[s], notFoundCount); | |
2322 | } | |
2323 | ||
2324 | uset_close(contractions); | |
2325 | uset_close(expansions); | |
2326 | uset_close(letters); | |
2327 | ||
2328 | CollData::close(monkeyData); | |
2329 | ||
2330 | ucol_close(coll); | |
2331 | } | |
2332 | ||
2333 | void SSearchTest::bmMonkeyTest(char *params) | |
2334 | { | |
2335 | static const UVersionInfo icu47 = { 4, 7, 0, 0 }; // for timebomb | |
2336 | static const UChar skipChars[] = { 0x0E40, 0x0E41, 0x0E42, 0x0E43, 0x0E44, 0xAAB5, 0xAAB6, 0xAAB9, 0xAABB, 0xAABC, 0 }; // for timebomb | |
2337 | // ook! | |
2338 | UErrorCode status = U_ZERO_ERROR; | |
2339 | UCollator *coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status); | |
2340 | ||
2341 | if (U_FAILURE(status)) { | |
2342 | errcheckln(status, "Failed to create collator in MonkeyTest! - %s", u_errorName(status)); | |
2343 | return; | |
2344 | } | |
2345 | ||
2346 | CollData *monkeyData = CollData::open(coll, status); | |
2347 | ||
2348 | USet *expansions = uset_openEmpty(); | |
2349 | USet *contractions = uset_openEmpty(); | |
2350 | ||
2351 | ucol_getContractionsAndExpansions(coll, contractions, expansions, FALSE, &status); | |
2352 | ||
2353 | U_STRING_DECL(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39); | |
2354 | U_STRING_INIT(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39); | |
2355 | USet *letters = uset_openPattern(letter_pattern, 39, &status); | |
2356 | SetMonkey letterMonkey(letters); | |
2357 | StringSetMonkey contractionMonkey(contractions, coll, monkeyData); | |
2358 | StringSetMonkey expansionMonkey(expansions, coll, monkeyData); | |
2359 | UnicodeString testCase; | |
2360 | UnicodeString alternate; | |
2361 | UnicodeString pattern, altPattern; | |
2362 | UnicodeString prefix, altPrefix; | |
2363 | UnicodeString suffix, altSuffix; | |
2364 | ||
2365 | Monkey *monkeys[] = { | |
2366 | &letterMonkey, | |
2367 | &contractionMonkey, | |
2368 | &expansionMonkey, | |
2369 | &contractionMonkey, | |
2370 | &expansionMonkey, | |
2371 | &contractionMonkey, | |
2372 | &expansionMonkey, | |
2373 | &contractionMonkey, | |
2374 | &expansionMonkey}; | |
2375 | int32_t monkeyCount = sizeof(monkeys) / sizeof(monkeys[0]); | |
2376 | // int32_t nonMatchCount = 0; | |
2377 | ||
2378 | UCollationStrength strengths[] = {UCOL_PRIMARY, UCOL_SECONDARY, UCOL_TERTIARY}; | |
2379 | const char *strengthNames[] = {"primary", "secondary", "tertiary"}; | |
2380 | int32_t strengthCount = sizeof(strengths) / sizeof(strengths[0]); | |
2381 | int32_t loopCount = quick? 1000 : 10000; | |
2382 | int32_t firstStrength = 0; | |
2383 | int32_t lastStrength = strengthCount - 1; //*/ 0; | |
2384 | ||
2385 | if (params != NULL) { | |
2386 | #if !UCONFIG_NO_REGULAR_EXPRESSIONS | |
2387 | UnicodeString p(params); | |
2388 | ||
2389 | loopCount = getIntParam("loop", p, loopCount); | |
2390 | m_seed = getIntParam("seed", p, m_seed); | |
2391 | ||
2392 | RegexMatcher m(" *strength *= *(primary|secondary|tertiary) *", p, 0, status); | |
2393 | if (m.find()) { | |
2394 | UnicodeString breakType = m.group(1, status); | |
2395 | ||
2396 | for (int32_t s = 0; s < strengthCount; s += 1) { | |
2397 | if (breakType == strengthNames[s]) { | |
2398 | firstStrength = lastStrength = s; | |
2399 | break; | |
2400 | } | |
2401 | } | |
2402 | ||
2403 | m.reset(); | |
2404 | p = m.replaceFirst("", status); | |
2405 | } | |
2406 | ||
2407 | if (RegexMatcher("\\S", p, 0, status).find()) { | |
2408 | // Each option is stripped out of the option string as it is processed. | |
2409 | // All options have been checked. The option string should have been completely emptied.. | |
2410 | char buf[100]; | |
2411 | p.extract(buf, sizeof(buf), NULL, status); | |
2412 | buf[sizeof(buf)-1] = 0; | |
2413 | errln("Unrecognized or extra parameter: %s\n", buf); | |
2414 | return; | |
2415 | } | |
2416 | #else | |
2417 | infoln("SSearchTest built with UCONFIG_NO_REGULAR_EXPRESSIONS: ignoring parameters."); | |
2418 | #endif | |
2419 | } | |
2420 | ||
2421 | for(int32_t s = firstStrength; s <= lastStrength; s += 1) { | |
2422 | int32_t notFoundCount = 0; | |
2423 | ||
2424 | logln("Setting strength to %s.", strengthNames[s]); | |
2425 | ucol_setStrength(coll, strengths[s]); | |
2426 | ||
2427 | CollData *data = CollData::open(coll, status); | |
2428 | ||
2429 | UnicodeString skipString(skipChars); // for timebomb | |
2430 | UnicodeSet* skipSet = UnicodeSet::createFromAll(skipString); // for timebomb | |
2431 | // TODO: try alternate prefix and suffix too? | |
2432 | // TODO: alterntaes are only equal at primary strength. Is this OK? | |
2433 | for(int32_t t = 0; t < loopCount; t += 1) { | |
2434 | uint32_t seed = m_seed; | |
2435 | // int32_t nmc = 0; | |
2436 | ||
2437 | generateTestCase(coll, monkeys, monkeyCount, pattern, altPattern); | |
2438 | generateTestCase(coll, monkeys, monkeyCount, prefix, altPrefix); | |
2439 | generateTestCase(coll, monkeys, monkeyCount, suffix, altSuffix); | |
2440 | ||
2441 | if (!isICUVersionAtLeast(icu47) && skipSet->containsSome(pattern)) { | |
2442 | continue; // timebomb until ticket #8080 is resolved | |
2443 | } | |
2444 | ||
2445 | BoyerMooreSearch pat(data, pattern, NULL, status); | |
2446 | BoyerMooreSearch alt(data, altPattern, NULL, status); | |
2447 | ||
2448 | // **** need a better way to deal with this **** | |
2449 | #if 0 | |
2450 | if (pat.empty() || | |
2451 | alt.empty()) { | |
2452 | continue; | |
2453 | } | |
2454 | #endif | |
2455 | ||
2456 | // pattern | |
2457 | notFoundCount += bmMonkeyTestCase(coll, pattern, pattern, altPattern, &pat, &alt, "pattern", strengthNames[s], seed); | |
2458 | ||
2459 | testCase.remove(); | |
2460 | testCase.append(prefix); | |
2461 | testCase.append(/*alt*/pattern); | |
2462 | ||
2463 | // prefix + pattern | |
2464 | notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "prefix + pattern", strengthNames[s], seed); | |
2465 | ||
2466 | testCase.append(suffix); | |
2467 | ||
2468 | // prefix + pattern + suffix | |
2469 | notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "prefix + pattern + suffix", strengthNames[s], seed); | |
2470 | ||
2471 | testCase.remove(); | |
2472 | testCase.append(pattern); | |
2473 | testCase.append(suffix); | |
2474 | ||
2475 | // pattern + suffix | |
2476 | notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "pattern + suffix", strengthNames[s], seed); | |
2477 | } | |
2478 | delete skipSet; // for timebomb | |
2479 | ||
2480 | CollData::close(data); | |
2481 | ||
2482 | logln("For strength %s the not found count is %d.", strengthNames[s], notFoundCount); | |
2483 | } | |
2484 | ||
2485 | uset_close(contractions); | |
2486 | uset_close(expansions); | |
2487 | uset_close(letters); | |
2488 | ||
2489 | CollData::close(monkeyData); | |
2490 | ||
2491 | ucol_close(coll); | |
2492 | } | |
2493 | ||
2494 | void SSearchTest::stringListTest(){ | |
2495 | UErrorCode status = U_ZERO_ERROR; | |
2496 | StringList *sl = new StringList(status); | |
2497 | if(U_FAILURE(status)){ | |
2498 | errln("ERROR: stringListTest: Could not start StringList"); | |
2499 | } | |
2500 | ||
2501 | const UChar chars[] = { | |
2502 | 0x0000 | |
2503 | }; | |
2504 | sl->add(chars, (int32_t) 0, status); | |
2505 | if(U_FAILURE(status)){ | |
2506 | errln("ERROR: stringListTest: StringList::add"); | |
2507 | } | |
2508 | ||
2509 | if(sl->getDynamicClassID() != StringList::getStaticClassID()){ | |
2510 | errln("ERROR: stringListTest: getDynamicClassID and getStaticClassID does not match"); | |
2511 | } | |
2512 | delete sl; | |
2513 | } | |
2514 | ||
2515 | #endif | |
2516 | ||
2517 | #endif |